ID: 1072924844

View in Genome Browser
Species Human (GRCh38)
Location 10:99608171-99608193
Sequence CAGGTAGTTCATGTGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072924844_1072924852 5 Left 1072924844 10:99608171-99608193 CCAGGTGTCACATGAACTACCTG No data
Right 1072924852 10:99608199-99608221 CCACAGAGGCTCTGGACCTGGGG No data
1072924844_1072924850 4 Left 1072924844 10:99608171-99608193 CCAGGTGTCACATGAACTACCTG No data
Right 1072924850 10:99608198-99608220 TCCACAGAGGCTCTGGACCTGGG No data
1072924844_1072924848 -3 Left 1072924844 10:99608171-99608193 CCAGGTGTCACATGAACTACCTG No data
Right 1072924848 10:99608191-99608213 CTGGCTCTCCACAGAGGCTCTGG No data
1072924844_1072924846 -9 Left 1072924844 10:99608171-99608193 CCAGGTGTCACATGAACTACCTG No data
Right 1072924846 10:99608185-99608207 AACTACCTGGCTCTCCACAGAGG No data
1072924844_1072924849 3 Left 1072924844 10:99608171-99608193 CCAGGTGTCACATGAACTACCTG No data
Right 1072924849 10:99608197-99608219 CTCCACAGAGGCTCTGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072924844 Original CRISPR CAGGTAGTTCATGTGACACC TGG (reversed) Intergenic
No off target data available for this crispr