ID: 1072924848

View in Genome Browser
Species Human (GRCh38)
Location 10:99608191-99608213
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072924844_1072924848 -3 Left 1072924844 10:99608171-99608193 CCAGGTGTCACATGAACTACCTG No data
Right 1072924848 10:99608191-99608213 CTGGCTCTCCACAGAGGCTCTGG No data
1072924841_1072924848 27 Left 1072924841 10:99608141-99608163 CCACTTGATGATGGCTTGGTACT No data
Right 1072924848 10:99608191-99608213 CTGGCTCTCCACAGAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072924848 Original CRISPR CTGGCTCTCCACAGAGGCTC TGG Intergenic