ID: 1072924850

View in Genome Browser
Species Human (GRCh38)
Location 10:99608198-99608220
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072924844_1072924850 4 Left 1072924844 10:99608171-99608193 CCAGGTGTCACATGAACTACCTG No data
Right 1072924850 10:99608198-99608220 TCCACAGAGGCTCTGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072924850 Original CRISPR TCCACAGAGGCTCTGGACCT GGG Intergenic
No off target data available for this crispr