ID: 1072926472

View in Genome Browser
Species Human (GRCh38)
Location 10:99620945-99620967
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072926472_1072926482 15 Left 1072926472 10:99620945-99620967 CCCGCGCTCCCGTGCGCTCCTCA No data
Right 1072926482 10:99620983-99621005 GGCTGGAGAGCGGGCGGCCCTGG No data
1072926472_1072926479 5 Left 1072926472 10:99620945-99620967 CCCGCGCTCCCGTGCGCTCCTCA No data
Right 1072926479 10:99620973-99620995 TGAGACGCGTGGCTGGAGAGCGG No data
1072926472_1072926481 9 Left 1072926472 10:99620945-99620967 CCCGCGCTCCCGTGCGCTCCTCA No data
Right 1072926481 10:99620977-99620999 ACGCGTGGCTGGAGAGCGGGCGG No data
1072926472_1072926476 -6 Left 1072926472 10:99620945-99620967 CCCGCGCTCCCGTGCGCTCCTCA No data
Right 1072926476 10:99620962-99620984 TCCTCAAATTCTGAGACGCGTGG No data
1072926472_1072926483 21 Left 1072926472 10:99620945-99620967 CCCGCGCTCCCGTGCGCTCCTCA No data
Right 1072926483 10:99620989-99621011 AGAGCGGGCGGCCCTGGCCCCGG No data
1072926472_1072926478 -2 Left 1072926472 10:99620945-99620967 CCCGCGCTCCCGTGCGCTCCTCA No data
Right 1072926478 10:99620966-99620988 CAAATTCTGAGACGCGTGGCTGG No data
1072926472_1072926480 6 Left 1072926472 10:99620945-99620967 CCCGCGCTCCCGTGCGCTCCTCA No data
Right 1072926480 10:99620974-99620996 GAGACGCGTGGCTGGAGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072926472 Original CRISPR TGAGGAGCGCACGGGAGCGC GGG (reversed) Intergenic
No off target data available for this crispr