ID: 1072926478

View in Genome Browser
Species Human (GRCh38)
Location 10:99620966-99620988
Sequence CAAATTCTGAGACGCGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072926471_1072926478 7 Left 1072926471 10:99620936-99620958 CCGTTACGACCCGCGCTCCCGTG No data
Right 1072926478 10:99620966-99620988 CAAATTCTGAGACGCGTGGCTGG No data
1072926474_1072926478 -10 Left 1072926474 10:99620953-99620975 CCCGTGCGCTCCTCAAATTCTGA No data
Right 1072926478 10:99620966-99620988 CAAATTCTGAGACGCGTGGCTGG No data
1072926473_1072926478 -3 Left 1072926473 10:99620946-99620968 CCGCGCTCCCGTGCGCTCCTCAA No data
Right 1072926478 10:99620966-99620988 CAAATTCTGAGACGCGTGGCTGG No data
1072926472_1072926478 -2 Left 1072926472 10:99620945-99620967 CCCGCGCTCCCGTGCGCTCCTCA No data
Right 1072926478 10:99620966-99620988 CAAATTCTGAGACGCGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072926478 Original CRISPR CAAATTCTGAGACGCGTGGC TGG Intergenic
No off target data available for this crispr