ID: 1072933217

View in Genome Browser
Species Human (GRCh38)
Location 10:99686324-99686346
Sequence CTGCATAGTAATTGCAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072933217_1072933221 11 Left 1072933217 10:99686324-99686346 CCTTCATTGCAATTACTATGCAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1072933221 10:99686358-99686380 CCCTGGAATCTCACACTATTGGG No data
1072933217_1072933219 10 Left 1072933217 10:99686324-99686346 CCTTCATTGCAATTACTATGCAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1072933219 10:99686357-99686379 TCCCTGGAATCTCACACTATTGG No data
1072933217_1072933218 -6 Left 1072933217 10:99686324-99686346 CCTTCATTGCAATTACTATGCAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1072933218 10:99686341-99686363 ATGCAGTATTGATAATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072933217 Original CRISPR CTGCATAGTAATTGCAATGA AGG (reversed) Intronic
901865138 1:12101517-12101539 CTGCATAGCACATGCAATTATGG - Intronic
902681710 1:18048374-18048396 ATGCAGAGTAAGTACAATGAAGG + Intergenic
908404797 1:63804200-63804222 CTGTATTGTAATTGTAATGGTGG + Intronic
909257537 1:73443443-73443465 CTGAATAGTCATTGCAAATAAGG + Intergenic
909262567 1:73511509-73511531 CTACATCTTGATTGCAATGATGG + Intergenic
909994128 1:82258452-82258474 CTGCACAGTAAGTGCTATGAAGG + Intergenic
911037628 1:93567222-93567244 CTGTATCGTAATTGAAATGAAGG - Intronic
911878761 1:103205141-103205163 ATGCATAGTATATTCAATGATGG - Intergenic
912453750 1:109784122-109784144 CTCCAAAGTAACTGCAATGTTGG - Intergenic
913327678 1:117641101-117641123 CTGCACACTAATGTCAATGATGG - Intergenic
917450071 1:175140616-175140638 TTGCATGTTAACTGCAATGAGGG + Intronic
917649207 1:177060152-177060174 CTGGAAAGTAAGTGCTATGATGG - Intronic
921919759 1:220654535-220654557 CTGCATAGTAATTGCCCCAATGG - Intronic
922080302 1:222289185-222289207 CTGCAGAGTAAATGCAATCATGG + Intergenic
923463627 1:234229468-234229490 CTGCATAGCTTTTACAATGAAGG - Intronic
923858945 1:237873660-237873682 CTGCATGGTAATTGCAAAAAGGG + Intergenic
923964716 1:239124716-239124738 CTACAATGTAATTGCCATGAGGG - Intergenic
1064046111 10:12017196-12017218 TTGCATAGTAATTGTCATTAGGG - Intronic
1064401654 10:15026283-15026305 GTGCATAGAAAATGCAAAGAAGG - Intergenic
1069652186 10:70057440-70057462 ATTCATAGTCATTGCAATGTTGG - Intronic
1071107982 10:82121056-82121078 CTGTAGAGTAACTGGAATGATGG - Intronic
1072933217 10:99686324-99686346 CTGCATAGTAATTGCAATGAAGG - Intronic
1079354743 11:19720934-19720956 CTTCATAGTAACTTCAAAGAAGG - Intronic
1080330122 11:31127218-31127240 CAGAAAAGTAATTGTAATGAAGG - Intronic
1083272215 11:61578282-61578304 CTGCATAGTAAGTGGGATGAGGG + Intronic
1084311634 11:68319760-68319782 ATGCTTTGTAATAGCAATGAAGG - Intronic
1088024871 11:105166633-105166655 CTGCAAAATAATTCCAATGCAGG + Intergenic
1088035505 11:105308613-105308635 CTGAATAGTTATTGCTGTGAAGG + Intergenic
1089083941 11:115800917-115800939 CTGCATAGAAAGGACAATGACGG - Intergenic
1090545902 11:127767821-127767843 CTGCAGGATAATTGCAATGCTGG + Intergenic
1092836449 12:12493536-12493558 CTGCATAGGACTTGGAAAGACGG - Intronic
1094545535 12:31401278-31401300 CAGCTTAGAAATGGCAATGATGG + Intronic
1095788966 12:46143504-46143526 CTGAATAGTAAGGGTAATGATGG + Intergenic
1096872029 12:54598975-54598997 GAGCATAGGAAATGCAATGAGGG + Intergenic
1098498162 12:71161058-71161080 ATGAATAGTAATTGGCATGATGG - Intronic
1099135469 12:78893085-78893107 ATGCATACTGATTGTAATGATGG - Intronic
1102782061 12:115573787-115573809 GTGCAAAGTAATTGCAATTTTGG - Intergenic
1106155746 13:27154193-27154215 CAGCATAGTAATTTAAATGATGG - Intronic
1108210726 13:48137529-48137551 CTGTGTAGAAAATGCAATGAGGG - Intergenic
1108688318 13:52839960-52839982 CTGCATAATAATAGGAATAAGGG - Intergenic
1110052912 13:70926536-70926558 ATGTATAGTTTTTGCAATGAAGG - Intergenic
1113517117 13:110912169-110912191 CTGCATTGTGATTGGAGTGAGGG - Intronic
1116464606 14:45216685-45216707 CTGTGTAGTAATTGAAAGGAGGG - Intronic
1120937992 14:89917597-89917619 CTGCCTAGTAATGATAATGATGG - Intronic
1123197009 14:106626804-106626826 CTGCATATGAATTTCAAAGAGGG + Intergenic
1124952760 15:34338350-34338372 CTACATAAAAATTACAATGAGGG - Intergenic
1125087304 15:35745339-35745361 CTGCACAGTCATTACAAAGAGGG + Intergenic
1126435136 15:48629638-48629660 CTTCAAAATAAATGCAATGAGGG + Intronic
1127118149 15:55747479-55747501 ATGCATAGGAAATGCAGTGATGG + Intergenic
1130833058 15:87621456-87621478 CTACATAGTAATCTCCATGAAGG - Intergenic
1131566144 15:93487244-93487266 CTGCATAAGAAATTCAATGACGG + Intergenic
1133704914 16:8345101-8345123 TTGAATAGTGATGGCAATGAAGG + Intergenic
1134375629 16:13670208-13670230 CTAAAGAGTAATTTCAATGAGGG - Intergenic
1135964923 16:27027910-27027932 GTGCATAGCAATGGCAAAGAGGG - Intergenic
1136291955 16:29279268-29279290 CTACCTAGGAATTGAAATGAGGG + Intergenic
1136496008 16:30644806-30644828 CTGCACAGTAATTGCAAGTGGGG + Intergenic
1137859020 16:51827655-51827677 CTGCATAGGATTTGCTATCACGG - Intergenic
1138609786 16:58113829-58113851 CTGCATTGTAAGTGCAGTGGGGG - Exonic
1139642261 16:68300783-68300805 CTGGATAGTAATGGCCATTAGGG - Exonic
1140554957 16:75911329-75911351 TTGAATAGTACTTGGAATGAGGG - Intergenic
1142097844 16:88253223-88253245 CTACCTAGGAATTGAAATGAGGG + Intergenic
1146620968 17:34397497-34397519 CTGCATAGTAATTACAAAAATGG - Intergenic
1155469408 18:26175377-26175399 CTGCATTGTAGTCGCAATAAAGG + Intronic
1156574897 18:38303528-38303550 CTCCATTGTGATGGCAATGAGGG - Intergenic
1157267092 18:46234935-46234957 CTGCATAGACATTGAAATGGGGG + Intronic
1157731502 18:50008236-50008258 CTGTATAGTGAGTGCTATGAAGG - Intronic
1159414270 18:68124059-68124081 CTGCATAATAATTCCAAACATGG + Intergenic
1160355160 18:78221498-78221520 CTGCAGAGGAATTGCAAGGGCGG - Intergenic
1168356870 19:55706002-55706024 CTGCATAGCAGTTACAAAGAAGG + Intronic
928836053 2:35546640-35546662 CTGGATAGTAAATTCAGTGAAGG - Intergenic
930875155 2:56206878-56206900 CTGGAGAGTTTTTGCAATGAAGG + Intronic
932919139 2:75889787-75889809 CTGTATAGTAATTGCCAAAATGG + Intergenic
933043875 2:77508476-77508498 CAGCATAATTATTCCAATGAGGG - Intronic
933276837 2:80293093-80293115 CTCCATAGTGATTGCATTTATGG - Intronic
939394511 2:141611518-141611540 CTGCAGAGTAATAGCATTTAAGG - Intronic
942901753 2:181128651-181128673 CTTCAGAGTAATTGAAATCAAGG + Intergenic
947247039 2:228060401-228060423 CTGCTTAATTATTGCAATTATGG - Intronic
1169644409 20:7793648-7793670 CTGCATTGTCATTGCCATTATGG - Intergenic
1171888849 20:30688297-30688319 CTACATAGTAACTCCAAAGAGGG - Intergenic
1177647767 21:23921572-23921594 CCGCATAATAATTTCAGTGAGGG - Intergenic
1179110835 21:38443710-38443732 CTGGATAGAAAATGCAATGATGG - Intronic
1179110847 21:38443825-38443847 CTGGGTAGAAAATGCAATGATGG - Intronic
951278531 3:20718949-20718971 CTGCATAGTATATGTTATGAGGG - Intergenic
959472518 3:106769696-106769718 CTGCAGAGTTTCTGCAATGATGG + Intergenic
961801010 3:129449433-129449455 CTGGATAGTAATTTCCCTGAGGG + Intronic
961920477 3:130420026-130420048 ATGGATAGAAAATGCAATGAAGG - Intronic
962050728 3:131812139-131812161 CTGCATCCTAATTGCAATCCTGG - Intronic
963728201 3:148945605-148945627 CTTCATGGTGATTGCAATGGTGG + Intergenic
966817777 3:183903551-183903573 CTGAATATTAAGTGCAATGAAGG + Intergenic
967650195 3:191976117-191976139 CTGCATACTAATTGTATTCATGG + Intergenic
970512760 4:16797431-16797453 TTACATAAGAATTGCAATGACGG - Intronic
972329693 4:38053722-38053744 CTGCATAGTTATTGCCTTGCTGG + Intronic
974498132 4:62660191-62660213 CTGCATACTAACCGCAAAGAAGG - Intergenic
974606803 4:64162977-64162999 AAGAATAGTAACTGCAATGAGGG + Intergenic
981780762 4:148426789-148426811 CTTCATAGAAATTGCAATTGAGG - Intronic
983111741 4:163758607-163758629 CTGAATTGTAATTGCAATTTAGG - Intronic
983882405 4:172948277-172948299 CAACATAATAATTGCAAAGATGG - Intronic
988833274 5:35007577-35007599 TTGGAGAGTAATTGCATTGAGGG + Intronic
990876969 5:60496940-60496962 CTGCATAGTCAATAAAATGATGG - Intronic
994900107 5:105760373-105760395 CTGGATAGTGATTGGCATGATGG + Intergenic
1000188254 5:158881989-158882011 CTGCTTTGTATTTGCAAAGAAGG + Intronic
1002386007 5:178867976-178867998 TTGCAGAGCAATTGCAATCATGG + Intronic
1003204644 6:3996136-3996158 ATACATAGTATTTGCAAGGATGG + Intergenic
1003927366 6:10888664-10888686 CTGCATACGAATTGAACTGAAGG + Intronic
1003967077 6:11263072-11263094 ATGCATAGTAATTGCATTTTTGG + Intronic
1004009137 6:11664823-11664845 CTGTATAGTAATTGCTATAGTGG + Intergenic
1004616127 6:17291205-17291227 CTGCATAGCAATTTCAAGTAGGG + Intronic
1008039581 6:46782968-46782990 TTGCAACATAATTGCAATGATGG + Intergenic
1008357061 6:50567320-50567342 CTACATAGGCATTGGAATGACGG + Intergenic
1008667667 6:53732280-53732302 CTGCATTGAAATAGCAAGGAAGG - Intergenic
1012274445 6:97255514-97255536 CTTCATAGTAAATCCAAAGAAGG - Intronic
1012699227 6:102432246-102432268 CTGTATTGTTTTTGCAATGAGGG + Intergenic
1013630670 6:111983136-111983158 ATGCACAGTAAATGCAAGGATGG + Intergenic
1015012086 6:128362034-128362056 CTTTATAGTAATTGCAAGAATGG - Intronic
1018959031 6:168433405-168433427 CTGCATATAATTTGCAATGCTGG - Intergenic
1020463969 7:8455582-8455604 CTGGACAGTAATGGCAATGCAGG - Intronic
1020566416 7:9801871-9801893 CTGCATACTGTTTTCAATGATGG - Intergenic
1021819589 7:24483303-24483325 CTGCTTTGTGACTGCAATGATGG + Intergenic
1023368635 7:39490140-39490162 CTGCATAGTGAGGGGAATGAGGG + Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1028038218 7:86013075-86013097 CTTCATAGTACTTTCATTGAAGG + Intergenic
1036093674 8:5698493-5698515 CTGCATGATAAGTGCAATGATGG - Intergenic
1037176755 8:15956552-15956574 CTACATATTATTTTCAATGAGGG + Intergenic
1038134338 8:24769368-24769390 GTTCATACTAATAGCAATGAGGG - Intergenic
1041535939 8:58925649-58925671 CTGCATGGTAATTGGAACAACGG + Intronic
1045026822 8:98095382-98095404 CTGGATTGTGATTGCATTGAAGG + Intergenic
1046310355 8:112428098-112428120 CTAAATAGTAGTTGCAGTGATGG - Intronic
1048514430 8:135093095-135093117 CTACATAGTAACCGCAATGCAGG - Intergenic
1049286575 8:141778746-141778768 CAGCATAGTGCTTGCCATGAAGG + Intergenic
1051553180 9:18353263-18353285 GTGCATAGTAAGTGCTATGAAGG - Intergenic
1052739395 9:32378729-32378751 CTGCATGGTACTTTCAAGGATGG + Intergenic
1053234118 9:36437008-36437030 CTGCATAGGAATAGCTAAGAGGG - Intronic
1056540482 9:87566903-87566925 TTCCATAGTGATTGCAAGGAGGG - Intronic
1057618329 9:96613842-96613864 ATGCATATTCATTGCAGTGATGG - Intronic
1186604498 X:11076475-11076497 CTGGATATTAATTCCAAGGAGGG - Intergenic
1186954081 X:14660772-14660794 TTGCGTAGTAACTGGAATGATGG + Intronic
1189489936 X:41462900-41462922 CTGCAAAGTAAATGAAAAGACGG - Intronic
1192698396 X:73442967-73442989 ATGCTTAGCAATTGGAATGAAGG - Intergenic
1194318735 X:92415455-92415477 ATGCATTGTAATTGCATTGATGG - Intronic
1199281498 X:146005434-146005456 ATAAATAGTAATTGCTATGATGG + Intergenic
1200626871 Y:5528611-5528633 ATGCATTGTAATTGCATTGATGG - Intronic
1201748142 Y:17403054-17403076 CTGCATTGTAATAGGAATGTCGG - Intergenic
1201752525 Y:17448615-17448637 CTGCATAGATAATGAAATGAAGG + Intergenic