ID: 1072937467 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:99727083-99727105 |
| Sequence | GAGTACTCACACCGAATGTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 48 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 44} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072937467_1072937472 | 30 | Left | 1072937467 | 10:99727083-99727105 | CCCCACATTCGGTGTGAGTACTC | 0: 1 1: 0 2: 0 3: 3 4: 44 |
||
| Right | 1072937472 | 10:99727136-99727158 | TGTCATATCATGATTCAAGCTGG | 0: 1 1: 0 2: 2 3: 5 4: 102 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072937467 | Original CRISPR | GAGTACTCACACCGAATGTG GGG (reversed) | Exonic | ||