ID: 1072937467

View in Genome Browser
Species Human (GRCh38)
Location 10:99727083-99727105
Sequence GAGTACTCACACCGAATGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072937467_1072937472 30 Left 1072937467 10:99727083-99727105 CCCCACATTCGGTGTGAGTACTC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1072937472 10:99727136-99727158 TGTCATATCATGATTCAAGCTGG 0: 1
1: 0
2: 2
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072937467 Original CRISPR GAGTACTCACACCGAATGTG GGG (reversed) Exonic