ID: 1072937472

View in Genome Browser
Species Human (GRCh38)
Location 10:99727136-99727158
Sequence TGTCATATCATGATTCAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072937469_1072937472 28 Left 1072937469 10:99727085-99727107 CCACATTCGGTGTGAGTACTCCA 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1072937472 10:99727136-99727158 TGTCATATCATGATTCAAGCTGG 0: 1
1: 0
2: 2
3: 5
4: 102
1072937467_1072937472 30 Left 1072937467 10:99727083-99727105 CCCCACATTCGGTGTGAGTACTC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1072937472 10:99727136-99727158 TGTCATATCATGATTCAAGCTGG 0: 1
1: 0
2: 2
3: 5
4: 102
1072937471_1072937472 1 Left 1072937471 10:99727112-99727134 CCAGATGAACTTGAATTCTGTCA 0: 1
1: 0
2: 0
3: 11
4: 202
Right 1072937472 10:99727136-99727158 TGTCATATCATGATTCAAGCTGG 0: 1
1: 0
2: 2
3: 5
4: 102
1072937470_1072937472 8 Left 1072937470 10:99727105-99727127 CCATGTACCAGATGAACTTGAAT 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1072937472 10:99727136-99727158 TGTCATATCATGATTCAAGCTGG 0: 1
1: 0
2: 2
3: 5
4: 102
1072937468_1072937472 29 Left 1072937468 10:99727084-99727106 CCCACATTCGGTGTGAGTACTCC 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1072937472 10:99727136-99727158 TGTCATATCATGATTCAAGCTGG 0: 1
1: 0
2: 2
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072937472 Original CRISPR TGTCATATCATGATTCAAGC TGG Exonic