ID: 1072938100 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:99732451-99732473 |
| Sequence | ACTCCCGCCGGCCCGCCCCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 164 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 151} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072938100_1072938105 | 2 | Left | 1072938100 | 10:99732451-99732473 | CCCCGGGGCGGGCCGGCGGGAGT | 0: 1 1: 0 2: 0 3: 12 4: 151 |
||
| Right | 1072938105 | 10:99732476-99732498 | TAGTCAGTGGTGATTTCTTCTGG | 0: 1 1: 0 2: 1 3: 14 4: 209 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072938100 | Original CRISPR | ACTCCCGCCGGCCCGCCCCG GGG (reversed) | Intronic | ||