ID: 1072938100

View in Genome Browser
Species Human (GRCh38)
Location 10:99732451-99732473
Sequence ACTCCCGCCGGCCCGCCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072938100_1072938105 2 Left 1072938100 10:99732451-99732473 CCCCGGGGCGGGCCGGCGGGAGT 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1072938105 10:99732476-99732498 TAGTCAGTGGTGATTTCTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072938100 Original CRISPR ACTCCCGCCGGCCCGCCCCG GGG (reversed) Intronic