ID: 1072938918

View in Genome Browser
Species Human (GRCh38)
Location 10:99741588-99741610
Sequence CAGGGTCTCACCTGTTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072938914_1072938918 -3 Left 1072938914 10:99741568-99741590 CCTTCCTTTTTTTCTTTTGACAG 0: 1
1: 3
2: 36
3: 392
4: 2721
Right 1072938918 10:99741588-99741610 CAGGGTCTCACCTGTTGTCCAGG No data
1072938917_1072938918 -7 Left 1072938917 10:99741572-99741594 CCTTTTTTTCTTTTGACAGGGTC 0: 1
1: 12
2: 58
3: 308
4: 1319
Right 1072938918 10:99741588-99741610 CAGGGTCTCACCTGTTGTCCAGG No data
1072938911_1072938918 28 Left 1072938911 10:99741537-99741559 CCTTCTCCTTTTCTCTCTCTTTG 0: 1
1: 4
2: 58
3: 623
4: 4479
Right 1072938918 10:99741588-99741610 CAGGGTCTCACCTGTTGTCCAGG No data
1072938912_1072938918 22 Left 1072938912 10:99741543-99741565 CCTTTTCTCTCTCTTTGCTTTCC 0: 1
1: 2
2: 49
3: 400
4: 3234
Right 1072938918 10:99741588-99741610 CAGGGTCTCACCTGTTGTCCAGG No data
1072938913_1072938918 1 Left 1072938913 10:99741564-99741586 CCTTCCTTCCTTTTTTTCTTTTG 0: 2
1: 44
2: 821
3: 4761
4: 20651
Right 1072938918 10:99741588-99741610 CAGGGTCTCACCTGTTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072938918 Original CRISPR CAGGGTCTCACCTGTTGTCC AGG Intronic
No off target data available for this crispr