ID: 1072944687

View in Genome Browser
Species Human (GRCh38)
Location 10:99799102-99799124
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072944687_1072944691 -2 Left 1072944687 10:99799102-99799124 CCTGTACAGAGAAGGCCACGGGG 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1072944691 10:99799123-99799145 GGCTCACAGGCTGACCACCCTGG 0: 1
1: 0
2: 0
3: 14
4: 173
1072944687_1072944692 9 Left 1072944687 10:99799102-99799124 CCTGTACAGAGAAGGCCACGGGG 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1072944692 10:99799134-99799156 TGACCACCCTGGAGCTGCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072944687 Original CRISPR CCCCGTGGCCTTCTCTGTAC AGG (reversed) Intronic