ID: 1072946172

View in Genome Browser
Species Human (GRCh38)
Location 10:99811813-99811835
Sequence GATATTCATGGCCCCATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072946172_1072946179 26 Left 1072946172 10:99811813-99811835 CCTACTATGGGGCCATGAATATC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1072946179 10:99811862-99811884 TGTGTGCAGATTGTGGATGGAGG No data
1072946172_1072946177 19 Left 1072946172 10:99811813-99811835 CCTACTATGGGGCCATGAATATC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1072946177 10:99811855-99811877 ACATTTGTGTGTGCAGATTGTGG No data
1072946172_1072946178 23 Left 1072946172 10:99811813-99811835 CCTACTATGGGGCCATGAATATC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072946172 Original CRISPR GATATTCATGGCCCCATAGT AGG (reversed) Intronic
902209571 1:14894990-14895012 AATATTCATGGCCCTAGACTTGG - Intronic
902989179 1:20174209-20174231 GATATTTAAGGCCCCACTGTGGG + Intronic
910347270 1:86254631-86254653 CATATTCATGGCCACTTAATGGG + Intergenic
917935623 1:179863863-179863885 GAAAATCATGGACCCAGAGTTGG - Intronic
919164086 1:193870073-193870095 GATATTCATAGTCCTATTGTTGG - Intergenic
1065381555 10:25096197-25096219 GTTATTCAGGGCCCAAGAGTGGG + Intergenic
1072803976 10:98412520-98412542 GAGATTCCTGGCCCCATACCTGG - Intronic
1072946172 10:99811813-99811835 GATATTCATGGCCCCATAGTAGG - Intronic
1087821220 11:102714947-102714969 GACATTCAAGGCCCCACAATTGG + Intronic
1094008500 12:25781837-25781859 TATATTCAAGGCACCACAGTAGG + Intergenic
1094346589 12:29476550-29476572 GATATTCATGGCACCATGGCTGG + Intronic
1094859890 12:34451883-34451905 GATATTTATGTCCCCATTGAGGG - Intergenic
1096794198 12:54064262-54064284 GATTTGCCTGGCCCCAGAGTGGG + Intergenic
1104918663 12:132279287-132279309 GACTTTCATTGGCCCATAGTGGG - Intronic
1105629916 13:22152938-22152960 GATACTCATGGCACCAGAGATGG - Intergenic
1106533003 13:30612118-30612140 TATATTTTTGGCCCCATAGTAGG - Intronic
1110564723 13:76946728-76946750 AAAAATCATGGCCCCATAATGGG + Intergenic
1114854389 14:26420541-26420563 CATATTCATGGACACATAGAGGG + Intergenic
1118785069 14:69038828-69038850 GAGATTTATGACCCCATGGTAGG + Intergenic
1119146791 14:72323899-72323921 AATTTTTATGGCCACATAGTAGG + Intronic
1119167878 14:72510646-72510668 GATATTCAGGACCCCAGACTGGG - Intronic
1132666814 16:1084767-1084789 GATGTTCATCGCCCCAGAGAGGG + Intergenic
1133128899 16:3664286-3664308 CTTCTTCATGGCCTCATAGTAGG + Exonic
1140339650 16:74145121-74145143 GATTTTCATGACCCCAAGGTAGG - Intergenic
1157576386 18:48746628-48746650 GATAGTCACGGCCACATAGCAGG + Intronic
1157715008 18:49878730-49878752 GATCTTCATGACCCCAAAGTTGG + Intronic
926724270 2:15984922-15984944 GACATTCATGGCTCCGCAGTCGG - Intergenic
930040986 2:47123806-47123828 AATGTTTATGGCCACATAGTAGG + Intronic
930475180 2:51872714-51872736 GAAAGTCATTGCCCCATAGAAGG - Intergenic
1171294546 20:24005968-24005990 GATATTGATGGCGCCATCTTTGG + Intergenic
1171912711 20:30979739-30979761 GATATTCATGTTTCCAAAGTAGG + Intergenic
1176702163 21:10067705-10067727 AATATTCATGGCCACATAAAGGG - Intergenic
1177201988 21:17967832-17967854 GATATTGTTGGGCACATAGTAGG - Intronic
1182042420 22:27248822-27248844 TATCTTCCTGGCCCCATACTAGG - Intergenic
1185409999 22:50676861-50676883 CAGATTCCTGGCCCCATGGTTGG + Intergenic
949092590 3:47037-47059 AACATTTCTGGCCCCATAGTTGG + Intergenic
951425543 3:22540411-22540433 AATATTCATGGATACATAGTAGG - Intergenic
952592270 3:34971004-34971026 GATGTTCATGCCCCCATATCTGG + Intergenic
953957776 3:47244890-47244912 GATGTTGATGGCCACCTAGTGGG - Exonic
954952706 3:54489270-54489292 GATATTGAGGGGCCCAAAGTGGG + Intronic
957032853 3:75263115-75263137 AACATTTCTGGCCCCATAGTTGG + Intergenic
959337739 3:105087452-105087474 GTTCTTCATGGCCCCACAATTGG + Intergenic
967610035 3:191493845-191493867 CATATTCATGGCATCATAGAAGG + Intergenic
968236193 3:197031092-197031114 TAGCTTCATGGCCCCATAGGAGG - Intergenic
970741170 4:19239382-19239404 GATATTCATTGGCACTTAGTAGG - Intergenic
971877554 4:32325292-32325314 GATAGTGATGGCCATATAGTGGG - Intergenic
980374338 4:131923994-131924016 AATATTCATGGCCACATAAAGGG - Intergenic
987725039 5:21687263-21687285 GATATTGATGATCCAATAGTGGG + Intergenic
989748856 5:44866748-44866770 GATTTTTATGGCCCCATGCTAGG + Intergenic
995549441 5:113266319-113266341 GATATTCACTCCCCCAAAGTGGG + Intronic
997141351 5:131384515-131384537 GATAAGCAGAGCCCCATAGTAGG + Intronic
997523821 5:134539956-134539978 GACTTCCATGGCCCCATGGTGGG + Intronic
997899597 5:137753257-137753279 GCTCTTCATGGGCCCATAGGAGG + Exonic
999121983 5:149216836-149216858 CATCTTCATGGCCCTAAAGTTGG - Intronic
1001727552 5:173918891-173918913 GATTTTCATGGCCTCAAAATAGG - Intronic
1002083530 5:176752434-176752456 GATATTCGAGGTACCATAGTTGG + Intergenic
1002603181 5:180366541-180366563 GACAGTCCTGGCTCCATAGTTGG + Intergenic
1003232150 6:4264039-4264061 GATATTCATGGCAGCAAATTTGG + Intergenic
1003464897 6:6369568-6369590 GATATAAATGGCCCCAGACTAGG + Intergenic
1003793188 6:9570198-9570220 GATAGCCATGGCCAGATAGTGGG - Intergenic
1004341701 6:14813631-14813653 AATATTGCTGGACCCATAGTGGG - Intergenic
1005280351 6:24267430-24267452 AATTTTCATGGGCACATAGTAGG - Intronic
1011753837 6:90479289-90479311 TATATTCAAGATCCCATAGTAGG + Intergenic
1020698710 7:11449350-11449372 CATATTCCTGACCCCATAGCAGG - Intronic
1023207127 7:37763327-37763349 AATCTGCATGGCTCCATAGTTGG - Intronic
1031359412 7:120829955-120829977 GATATTCATGGCCTTAGTGTTGG - Intronic
1033943189 7:146681378-146681400 GTTATTCATGGACACATAGAGGG + Intronic
1046165935 8:110435643-110435665 GATTTTCATGGACCCACAGATGG - Intergenic
1053639309 9:40054115-40054137 AATATTCATGGCCACATAAAGGG - Intergenic
1053766769 9:41410989-41411011 AATATTCATGGCCACATAAAGGG + Intergenic
1054320112 9:63650779-63650801 AATATTCATGGCCACATAAAGGG - Intergenic
1054545436 9:66322503-66322525 AATATTCATGGCCACATAAAGGG + Intergenic
1055545498 9:77368651-77368673 GATACTCAGGGTCACATAGTGGG - Intronic
1061670476 9:132185459-132185481 AATATTCATGGCGGCAGAGTGGG + Intronic
1202787180 9_KI270719v1_random:37790-37812 AATATTCATGGCCACATAAAGGG - Intergenic
1194240317 X:91436655-91436677 GAGATGAATGGCCGCATAGTGGG + Exonic
1197001638 X:121446721-121446743 CATAGTCTTGGCCCCAGAGTAGG + Intergenic
1198699521 X:139382365-139382387 GCTATTCATGGCCCCAGGCTTGG + Intergenic