ID: 1072946173

View in Genome Browser
Species Human (GRCh38)
Location 10:99811825-99811847
Sequence GGATCACAGCTGGATATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 3, 3: 110, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072946173_1072946177 7 Left 1072946173 10:99811825-99811847 CCATGAATATCCAGCTGTGATCC 0: 1
1: 0
2: 3
3: 110
4: 320
Right 1072946177 10:99811855-99811877 ACATTTGTGTGTGCAGATTGTGG No data
1072946173_1072946178 11 Left 1072946173 10:99811825-99811847 CCATGAATATCCAGCTGTGATCC 0: 1
1: 0
2: 3
3: 110
4: 320
Right 1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG No data
1072946173_1072946179 14 Left 1072946173 10:99811825-99811847 CCATGAATATCCAGCTGTGATCC 0: 1
1: 0
2: 3
3: 110
4: 320
Right 1072946179 10:99811862-99811884 TGTGTGCAGATTGTGGATGGAGG No data
1072946173_1072946180 28 Left 1072946173 10:99811825-99811847 CCATGAATATCCAGCTGTGATCC 0: 1
1: 0
2: 3
3: 110
4: 320
Right 1072946180 10:99811876-99811898 GGATGGAGGTAGTGCAGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072946173 Original CRISPR GGATCACAGCTGGATATTCA TGG (reversed) Intronic
903475897 1:23619015-23619037 GGATCACAAAAGGATTTTCAGGG - Intronic
906353002 1:45079787-45079809 GTATCACTGCTGGTTATTCAGGG + Intronic
906877900 1:49558106-49558128 GTATCACTGCTGATTATTCAGGG - Intronic
908599011 1:65719001-65719023 GTATCACTGCTGGTTATTCAGGG + Intergenic
909316248 1:74223345-74223367 GTATCACTGCTGGTTATTCAGGG - Intronic
909594453 1:77390057-77390079 GGGTCTCAGCTGGACATTCAAGG + Intronic
909615675 1:77605815-77605837 GTGTCACTGCTGGTTATTCAAGG - Intronic
910289756 1:85588653-85588675 GTATCACTGCTGGTTATTCAGGG - Intergenic
910716418 1:90236111-90236133 GTATCACTACTGGTTATTCAGGG + Intergenic
911826043 1:102486179-102486201 GCATCACTGCTAGTTATTCAAGG - Intergenic
912280547 1:108308444-108308466 GTATCACTACTGGTTATTCAGGG + Intergenic
912287679 1:108385913-108385935 GTATCACTACTGGTTATTCAGGG - Intronic
912422176 1:109550389-109550411 GTATAACAGGTGGATATGCATGG + Intronic
915357052 1:155261719-155261741 GGATCACAGCTGGGTCCTGAGGG + Exonic
915856813 1:159397226-159397248 GTATCACTGCTGGTTATTCAGGG - Intergenic
916161733 1:161923033-161923055 GGATTTCAGCTGGATTTTGAAGG - Intronic
917226427 1:172788649-172788671 GTATCACTGCTGGTTATTCAGGG + Intergenic
917423690 1:174891587-174891609 GGATCAAACCTGGAATTTCAAGG - Intronic
918671618 1:187224246-187224268 GTATCACTGCTGGTTATTCAGGG + Intergenic
918725290 1:187913801-187913823 GGATCACAGTAGGAGATTCTGGG - Intergenic
919003116 1:191860311-191860333 GTATTACAGCTGGTTATTCAGGG - Intergenic
919336600 1:196244171-196244193 GTATCACAGCTGATTATTCAGGG - Intronic
919904763 1:202070586-202070608 TGATCACAGCTGGTTGCTCAGGG + Intergenic
920580083 1:207098290-207098312 TGTTCACAGCTGGATCTCCAGGG + Intronic
921042578 1:211448099-211448121 GTATCGCTGCTGGTTATTCAGGG - Intergenic
921456721 1:215380351-215380373 GTATCACTGCTGGTTATTCAGGG - Intergenic
921505979 1:215970951-215970973 GGTTTACAGTTTGATATTCAAGG - Intronic
923102250 1:230826036-230826058 AGAGCAGAGCTGGATATGCAAGG + Intergenic
923513212 1:234671579-234671601 GGAGCTCAGCTGGGTAATCATGG - Intergenic
924898883 1:248373283-248373305 GTATCACTGCTGGTTATTCAGGG + Intergenic
1064446567 10:15398994-15399016 GTATCACTGCTGGCTATTAAGGG - Intergenic
1065467782 10:26043981-26044003 GTATCACTGCTGGTCATTCAGGG + Intronic
1065921818 10:30399609-30399631 GTATCACTGTTGGCTATTCAAGG - Intergenic
1068104038 10:52591734-52591756 GTATCACTGCTGGTTATTCAGGG + Intergenic
1068226151 10:54108992-54109014 GTATCACTGCTGGTTATTCAGGG - Intronic
1069933604 10:71900227-71900249 GCATCGCTGCTGGTTATTCAGGG + Intergenic
1070059411 10:72967735-72967757 GTATCACTGTTGGTTATTCAGGG + Intergenic
1070914999 10:80147923-80147945 GTATCTCTGCTGGTTATTCAGGG - Intergenic
1071209146 10:83317649-83317671 GTATCGCTGCTGGTTATTCAGGG - Intergenic
1072083591 10:92057054-92057076 GTGTCACTGCTGGCTATTCAGGG - Intronic
1072438358 10:95433569-95433591 GGATTACAGGTTGACATTCAGGG + Intronic
1072946173 10:99811825-99811847 GGATCACAGCTGGATATTCATGG - Intronic
1073827128 10:107336866-107336888 ACATCACTGCTGGTTATTCAGGG + Intergenic
1074397893 10:113113902-113113924 GAATCACAGTGGGAAATTCAAGG - Intronic
1074597802 10:114883274-114883296 GGATCACAGCAGCTGATTCAGGG + Intronic
1074917655 10:117972674-117972696 TGTTCACAGCTGGATATTCTTGG - Intergenic
1077970240 11:7181707-7181729 GCATCACTGCTGGTTATTCAGGG - Intergenic
1078690865 11:13579346-13579368 GCATCACGGCTAGTTATTCAGGG - Intergenic
1079626027 11:22618442-22618464 GTATCACTGTTGGTTATTCAGGG + Intergenic
1080084225 11:28259045-28259067 GTATCACTGCTTGTTATTCAGGG + Intronic
1080413781 11:32050876-32050898 GGCTCAGAGCTGTATATTCCTGG - Intronic
1082195371 11:49298349-49298371 GTACCACTGCTGGTTATTCAAGG + Intergenic
1083505839 11:63156707-63156729 GTATCACTGCTAGTTATTCAGGG + Intronic
1084510835 11:69602602-69602624 GGATGACAGCTGGATCCTGAAGG - Intergenic
1086660562 11:89411203-89411225 GTACCACTGCTGGTTATTCAAGG - Intronic
1086925570 11:92636792-92636814 AGAACACAGCTGGATTGTCATGG - Intronic
1087532955 11:99407222-99407244 GTATTACTGCTGGTTATTCAGGG + Intronic
1088045740 11:105448888-105448910 GTATCACTGCTGGTTATTCAGGG - Intergenic
1088362041 11:109001384-109001406 GTATCACTGCTGATTATTCAGGG + Intergenic
1088375806 11:109140646-109140668 GTATCACTGCTGGTTATTCAAGG + Intergenic
1089016855 11:115172463-115172485 GGACCCCAGCTGGATCTTAAAGG - Exonic
1089762218 11:120736102-120736124 GTATCACTGTTGGTTATTCAGGG + Intronic
1089937055 11:122375448-122375470 GTGTCACTGCTGGTTATTCAGGG - Intergenic
1090136379 11:124203793-124203815 GTATCACTGCTGGTTACTCAGGG + Intergenic
1090676926 11:129007385-129007407 GTATCACTGCTGGTTATTCAGGG + Intronic
1091512165 12:1138807-1138829 GGATCACAGCAGGGAATTCAAGG - Intronic
1093003552 12:14026731-14026753 GGAAGACAGCAGGATACTCAAGG + Intergenic
1093650770 12:21642907-21642929 GCTTCACAGCTGGATTTTCCAGG - Intronic
1095227504 12:39695079-39695101 GCATCACTGATGGTTATTCAGGG - Intronic
1096361155 12:50988527-50988549 TGGGCACAGCTGGATGTTCAAGG - Intronic
1097563645 12:61239822-61239844 GTGTCACTGCTGGCTATTCAGGG + Intergenic
1098300997 12:69054142-69054164 ACATCCCAACTGGATATTCAAGG + Intergenic
1099610105 12:84857391-84857413 GTATCACTACTGGTTATTCAAGG + Intergenic
1099882224 12:88480503-88480525 GTATCACCACTGGTTATTCAGGG - Intergenic
1101026230 12:100609327-100609349 GTATCACTGCTGGTTATTCGGGG + Intronic
1102610235 12:114105544-114105566 GGATCAAAGGTGGTTATTCTTGG + Intergenic
1108158233 13:47610714-47610736 GAATCACTGCTGGAGATGCAAGG - Intergenic
1108493758 13:51005155-51005177 GGCTCACAGCAGGAAATCCAAGG + Intergenic
1109016457 13:57021179-57021201 GTATTACTGCTGGATATTCAGGG - Intergenic
1109826467 13:67728194-67728216 GTATTACTGCTGGTTATTCAGGG + Intergenic
1110501281 13:76231322-76231344 GTATCACTGCTGGTTATTCAGGG - Intergenic
1111542687 13:89689441-89689463 GTATCACAGTTGGTTATCCATGG - Intergenic
1113367067 13:109686169-109686191 GCCTGACAGCTGGATTTTCATGG - Intergenic
1114985158 14:28217565-28217587 GTAACACTGCTGGTTATTCAGGG + Intergenic
1115369821 14:32600693-32600715 GCAGCACAGCTGGATTCTCAGGG + Exonic
1116123370 14:40750145-40750167 GAAACACAGTTGTATATTCAAGG + Intergenic
1116351751 14:43871800-43871822 GTATCACTGCTGGTTATTCAGGG + Intergenic
1116407048 14:44579178-44579200 GTATCACTGCTGGTTATTCAGGG - Intergenic
1116481047 14:45391974-45391996 CTATCACTGCTGGTTATTCAGGG - Intergenic
1116504859 14:45665534-45665556 GTATCATTGCTGGTTATTCAGGG + Intergenic
1116679802 14:47952097-47952119 TGATCACTGCTGAATAGTCAAGG + Intergenic
1116889051 14:50249632-50249654 GTATCGCTGCTGGTTATTCAGGG - Intronic
1117264945 14:54076972-54076994 GTATCACTGCTGGTTATTCAGGG + Intergenic
1117483147 14:56168842-56168864 GTATCACTGCTGGTTATTCAGGG + Intronic
1117893253 14:60450007-60450029 GTATCACTCCTGGTTATTCAGGG - Intronic
1118666343 14:68074903-68074925 GGAGCACAGCTGCACATGCAAGG - Intronic
1120191569 14:81444703-81444725 TGATCACAGATGTAAATTCATGG - Intergenic
1121361709 14:93267483-93267505 TGAAAAGAGCTGGATATTCATGG - Intronic
1121375928 14:93410786-93410808 GCATCACTGTTGGTTATTCAAGG - Intronic
1121759791 14:96435262-96435284 GTATCACTGCTGGTTATTCAGGG + Intronic
1121983278 14:98473953-98473975 TGATCAGAGCTGGATATTCTTGG - Intergenic
1124048937 15:26177169-26177191 CTGTCACAGCTGGACATTCAGGG - Intergenic
1126534132 15:49742244-49742266 GTATCACTGCTGGATATTCAAGG - Intergenic
1127012433 15:54644678-54644700 GTATCACTGCTGGTTATTCAGGG - Intergenic
1127173472 15:56328316-56328338 GTGTCACTGCTGGTTATTCAGGG - Intronic
1127990704 15:64113970-64113992 GGACCACAGCAGGACATTCTTGG + Intronic
1129030642 15:72615375-72615397 GTATCACTGTTGGCTATTCAGGG + Intergenic
1129586004 15:76865861-76865883 AGATGACACATGGATATTCAGGG - Intronic
1130847333 15:87759492-87759514 GGGTCACAGCTGGATTTGTAGGG - Intergenic
1139220631 16:65178052-65178074 GGATCACACCTGTCTTTTCAAGG - Intergenic
1142317641 16:89358308-89358330 ACATCACAGCTGCATATTCACGG + Intronic
1142727770 17:1829428-1829450 GAATCACAGCTGGGAAATCAGGG - Intronic
1143057828 17:4175722-4175744 GTCTCACAGATGTATATTCATGG + Intronic
1144164657 17:12598016-12598038 CCATCACAGCTGGATTTGCAAGG - Intergenic
1144167049 17:12623203-12623225 GGGACACAGCTGGATAATCCTGG - Intergenic
1144674441 17:17152928-17152950 GGATCACAGCCGGAATTCCAGGG - Intronic
1149157373 17:53647921-53647943 GTATCGCTGCTGGTTATTCAGGG + Intergenic
1149234872 17:54578142-54578164 GTATCACTGCTGGTTATTCATGG - Intergenic
1150630786 17:66879014-66879036 GGATGTCAGCTGGGTGTTCATGG - Exonic
1153389222 18:4535056-4535078 GTATCACTGCTGGTTATTCAAGG + Intergenic
1155282110 18:24250586-24250608 GTATCACTGCTGGTTATTCAGGG - Intronic
1155407669 18:25507094-25507116 GGTACTCAGCTGGATACTCAAGG - Intergenic
1156807798 18:41207855-41207877 AAAGCACAGCTGAATATTCATGG + Intergenic
1158269515 18:55697633-55697655 GGGCCACAACTGGAGATTCATGG + Intergenic
1159048785 18:63397112-63397134 GGAAAACAGATGGTTATTCAGGG - Exonic
1159259282 18:65990966-65990988 GGATCTCAGATGGAAATTCTTGG + Intergenic
1159732809 18:72052669-72052691 AGATGATAGCTGGATATTCCAGG + Intergenic
1162859612 19:13496139-13496161 GGATCATAGCTGGATGTTTGTGG - Intronic
1164187495 19:22883461-22883483 GGATCACAGGTGGATAAGCTAGG + Intergenic
1166408358 19:42539810-42539832 GTATCACTACTGGTTATTCAGGG + Intronic
1167448050 19:49550598-49550620 GGATCACAGCTGGACCTCCTGGG + Intergenic
1167582207 19:50351809-50351831 GCATCACTGCTTGTTATTCAGGG + Intronic
925402771 2:3587378-3587400 GGATTTCAGCTGGATATGCTGGG + Intergenic
927291557 2:21409375-21409397 GCATCCCAGCTGGATCTTGAGGG - Intergenic
927818289 2:26240289-26240311 GGAGTACAGCAGGACATTCAGGG + Intronic
928495658 2:31829122-31829144 GTATCACTGCTGGCTATTCAGGG + Intergenic
932921173 2:75916796-75916818 GTATCACTGCTAGTTATTCAGGG + Intergenic
933025088 2:77246652-77246674 GAATTTCAGCTGGATTTTCAAGG - Intronic
933446609 2:82387661-82387683 GTATCACTGCTGATTATTCAGGG - Intergenic
935078646 2:99770650-99770672 GTATCACTGCTGGTTATTCAGGG + Intronic
935576594 2:104717579-104717601 GTGTCACTGCTGGTTATTCAGGG + Intergenic
936885029 2:117300032-117300054 GCATCACTGCTGGCTAATCAGGG - Intergenic
937287891 2:120764521-120764543 GGGTCACAGCTGGGTATTGGAGG + Intronic
937560548 2:123218967-123218989 GGATCACTGCTTGTTATTGAGGG - Intergenic
939144509 2:138396333-138396355 GTATCACTGCTGATTATTCAGGG - Intergenic
939710279 2:145508998-145509020 GTATCGCTGCTGGTTATTCAGGG + Intergenic
940315188 2:152320671-152320693 GTATCACTGCTGGTTGTTCAGGG + Intergenic
940560328 2:155287637-155287659 TTATCACTGCTGGTTATTCAAGG - Intergenic
941274663 2:163475968-163475990 GAAACACAGCTGGAAAGTCATGG + Intergenic
941357482 2:164511585-164511607 ATATCACTGCTGGTTATTCAGGG - Intronic
941851830 2:170191011-170191033 GTACCACCGCTGAATATTCAGGG + Intronic
942069882 2:172306721-172306743 GGAACACAGCAGAATACTCAGGG + Intergenic
942195998 2:173520820-173520842 GGATCACACCTGGATCTTCTGGG + Intergenic
942352293 2:175065395-175065417 GTATCGCTGCTGGTTATTCAGGG - Intergenic
942750044 2:179276937-179276959 GAATCACTGCTGGTTATTCAGGG - Intergenic
942778514 2:179613424-179613446 GGGTCACTGCTGATTATTCAGGG + Intronic
942814322 2:180034030-180034052 GTATCGCAGGTGGTTATTCAGGG + Intergenic
943117520 2:183691805-183691827 GTATCACTGCTGGTTCTTCAGGG + Intergenic
943427909 2:187759321-187759343 GTATCACTGCTGGTTATTCAGGG + Intergenic
945210215 2:207375069-207375091 GTATCTCTGCTGGTTATTCAGGG - Intergenic
945739769 2:213645419-213645441 GTATCGCTGCTGGTTATTCAGGG + Intronic
946984686 2:225258217-225258239 GTATCACTGCTGGTTATTCAGGG - Intergenic
1168742088 20:200560-200582 TTATCACTGCTGGTTATTCAGGG + Intergenic
1169617989 20:7471502-7471524 GTATCACTGCTGGTTATTCAGGG + Intergenic
1170086972 20:12544625-12544647 GTATCACTGCTGGTTATTCGGGG + Intergenic
1170236020 20:14105951-14105973 GTATCACTGTTGGTTATTCAGGG - Intronic
1170544891 20:17427480-17427502 GGTTCACAGCTGGACTGTCAGGG - Intronic
1170643123 20:18173511-18173533 AGATCACAGCAGCATATCCAAGG - Intronic
1172203606 20:33146026-33146048 ATATCACTGCTGGTTATTCAGGG + Intergenic
1173016144 20:39227590-39227612 GTTTCAAAGCAGGATATTCATGG + Intergenic
1173098911 20:40065335-40065357 GTATCACTGCTGGTTTTTCAGGG - Intergenic
1176917554 21:14644499-14644521 GTATCACTGCTGGCTATTCAGGG - Intronic
1177023784 21:15896259-15896281 GTATTACTGCTGGTTATTCAGGG - Intergenic
1177401027 21:20605678-20605700 GTATCACTGCTGGTTATTCAGGG - Intergenic
1177577922 21:22982717-22982739 GTATCACTGCTGGTTATTCAGGG - Intergenic
1179157682 21:38864098-38864120 GGCTCACAGCTGGGTTTTCTTGG + Intergenic
1179395900 21:41039815-41039837 GTATCACTGTTGGTTATTCAGGG - Intergenic
1182749458 22:32629819-32629841 GGAACAGAGCTGGATGATCAGGG + Intronic
1184862526 22:47181960-47181982 GTATCACTGCTGGTTATTCAGGG - Intergenic
1185100437 22:48837818-48837840 GGATCACAGCTGATTAGTCATGG + Intronic
950695659 3:14699420-14699442 GTATCACTGCTGGTTATTCAGGG + Intronic
951445213 3:22771386-22771408 GAGTCACAGCTGGAGATGCAAGG + Intergenic
951794540 3:26523840-26523862 GTATCACTGCTGGTTATTCAGGG + Intergenic
951907499 3:27719801-27719823 GGAAGACAGTTGGATATTTATGG + Intronic
952428365 3:33198622-33198644 GGATAAGAGCTGGATATACAGGG - Intronic
952517917 3:34124494-34124516 GTATCACTGCTGATTATTCAGGG + Intergenic
953054027 3:39373066-39373088 GGATCACATGTGCAAATTCAAGG - Intergenic
953309549 3:41863613-41863635 GTATCACTGCTGGTTATTCAGGG + Intronic
954488062 3:50873202-50873224 GTATCACTCCTGGTTATTCAGGG + Intronic
954574410 3:51667713-51667735 GGATCACAGCAGAATACACAGGG - Exonic
954879075 3:53821802-53821824 GGAGAACAGCTGGCTTTTCAGGG - Intronic
956476099 3:69621721-69621743 ATATCACTGCTGGCTATTCAAGG - Intergenic
956721948 3:72125716-72125738 GGATCACCTCTGCATCTTCAAGG - Intergenic
958558443 3:95709943-95709965 TGATCACATCAGGGTATTCAGGG - Intergenic
958669151 3:97180520-97180542 GGATCACTGCTGGTTATTCAGGG + Intronic
959762014 3:109977003-109977025 GTATCACTGCTGGTTATTCAGGG + Intergenic
959798144 3:110457303-110457325 ATATCACTGCTGGTTATTCAGGG + Intergenic
960329647 3:116343124-116343146 GGATCAGAGATGGATGGTCAAGG - Intronic
960490732 3:118314022-118314044 GTACCACTGCTGGTTATTCAAGG - Intergenic
960521184 3:118657767-118657789 GTATCAATGCTGGATATTCAGGG + Intergenic
960869990 3:122238906-122238928 GTATCACCGTTGGTTATTCAGGG - Intronic
962033525 3:131626669-131626691 TGATCATAGCTGGATCTTCTGGG - Intronic
962151920 3:132902558-132902580 GTATCACTGCTGGTTATTCAGGG - Intergenic
963175862 3:142297230-142297252 GGAACACAGCTGGGTTTTAAAGG - Intergenic
964244255 3:154632903-154632925 GTATCACTGCTAGTTATTCAGGG + Intergenic
966660568 3:182410108-182410130 GGATCACAGGGGGATTTTTAGGG + Intergenic
967630343 3:191737816-191737838 GTATCACTACTGGTTATTCAGGG + Intergenic
968334411 3:197900920-197900942 GGACCCCTGCTGGTTATTCAGGG - Intronic
968438189 4:606471-606493 TGATCTCAGCTGGATGTTCCGGG - Intergenic
971105292 4:23517759-23517781 GTATCACCACTGGTTATTCACGG + Intergenic
971914585 4:32851382-32851404 GTATCACTGCTGGTTATTTAGGG + Intergenic
972444965 4:39135299-39135321 GGATCCCAGGTGGAAATCCACGG + Intergenic
972468797 4:39384242-39384264 GTATCACCGCTGGTTTTTCAGGG + Intergenic
972851582 4:43057232-43057254 GTATCGCTGCTGGTTATTCAGGG - Intergenic
972904467 4:43728194-43728216 GTATCACTGATGGTTATTCAGGG - Intergenic
973327456 4:48877963-48877985 GTATCACTGCTGGTTATTCAGGG + Intergenic
973852753 4:54977418-54977440 GTATCACTGCCGGTTATTCAGGG - Intergenic
974290312 4:59921243-59921265 GTATCACTGCTGGTTATTCAGGG - Intergenic
974337609 4:60570231-60570253 GGATCGCTGCTGGTTATTCAGGG + Intergenic
975035055 4:69669428-69669450 GTATCACTGCTTGTTATTCAGGG - Intergenic
975503888 4:75117215-75117237 GTATCACTGCTGATTATTCAGGG - Intergenic
975629754 4:76388058-76388080 GTATCACTGCTGGTTATTCAGGG - Intronic
976982045 4:91243744-91243766 GTATTACTGCTGGTTATTCAGGG - Intronic
977527847 4:98166248-98166270 TTATCACCGCTGGTTATTCAGGG + Intergenic
977744971 4:100535769-100535791 GTATCACTGCTGGTTATTCAGGG - Intronic
978030906 4:103939044-103939066 GTATCACTGCTGGTTATTCAGGG - Intergenic
978190584 4:105906517-105906539 CCATCACAGCTAGATATTCTGGG - Intronic
979413446 4:120406752-120406774 GTATCACTGCTGGTTATTCAGGG - Intergenic
979504474 4:121479922-121479944 GTATCACTGCTGGTTATTCAGGG + Intergenic
979595023 4:122525358-122525380 GTATCACTGTTGGTTATTCAGGG + Intergenic
979878787 4:125928471-125928493 GTATCGCTGCTGGTTATTCAGGG - Intergenic
980172418 4:129305905-129305927 GTATCACTGCTGATTATTCAAGG + Intergenic
980723550 4:136727968-136727990 GTATGACTGCTGGTTATTCAGGG + Intergenic
981298143 4:143156437-143156459 GTATCACTGCTGGTTATTCAGGG + Intergenic
981871109 4:149487097-149487119 GTATCACTGCTGGTTATTCAAGG + Intergenic
981975544 4:150723539-150723561 TTATCACTGCTGGTTATTCAGGG - Intronic
982309352 4:153968315-153968337 GCATCAGAGCTGGATTGTCAAGG - Intergenic
983456272 4:167968708-167968730 GTATCACTGCTGGTTATTCAGGG - Intergenic
984068520 4:175081906-175081928 GTACCACTGCTGGTTATTCAAGG + Intergenic
984529786 4:180902113-180902135 GTATCACTGCTGGTTATTCAGGG + Intergenic
988001724 5:25358366-25358388 GTATCACTGTTGGTTATTCAGGG - Intergenic
988956344 5:36324026-36324048 GTATCGCTGCTGGTTATTCAGGG + Intergenic
990327740 5:54694727-54694749 GGATCTCAGCTGGGTGATCACGG + Intergenic
991205236 5:64042248-64042270 GTATTACTGCTGGTTATTCAGGG - Intergenic
992454262 5:76901877-76901899 GTATCACTGCTGGTTATTCAGGG + Intronic
993171045 5:84419467-84419489 CTATCACTGCTGGTTATTCAGGG - Intergenic
993207079 5:84895375-84895397 GTATCACTGCTGGTTATTCAGGG + Intergenic
993278883 5:85898830-85898852 GTATCACTGCTGGTTATTCAGGG + Intergenic
995146928 5:108797038-108797060 GTATCACTGCTGGTTATTCAGGG + Intronic
995623121 5:114049695-114049717 GAAACAGGGCTGGATATTCAGGG + Intergenic
996021672 5:118597743-118597765 GACTCACAGCTGGATTTTAAGGG - Intergenic
996161610 5:120173677-120173699 GTATCACTGATGGTTATTCACGG - Intergenic
996557575 5:124794890-124794912 TGTTCAAAGCTGGATATGCATGG - Intergenic
996931653 5:128896328-128896350 GCATCACTGCCGGTTATTCAAGG + Intronic
998058131 5:139096785-139096807 GCATCATTGCTGGTTATTCAGGG - Intronic
998716375 5:144889407-144889429 GCATCATTGCTGGTTATTCAGGG - Intergenic
999493039 5:152070461-152070483 GGATCTCAGCTTCATCTTCATGG + Intergenic
1000651340 5:163822200-163822222 GTATCACTGTTGGTTATTCAGGG + Intergenic
1001294102 5:170486747-170486769 GGGCCACAGCTTGATAGTCAAGG + Intronic
1001845369 5:174917097-174917119 GTATCACTGTTGGCTATTCAGGG - Intergenic
1002052412 5:176578595-176578617 GGCTCACACCTGGATGGTCACGG - Exonic
1002255721 5:177957318-177957340 GCATCAAAGCTGGAATTTCAGGG + Intergenic
1003437975 6:6111573-6111595 GTATTACTGCTGGTTATTCAGGG + Intergenic
1006761474 6:36465863-36465885 GCTTCACAGCTGTATATTCTGGG + Intronic
1010139942 6:72602446-72602468 GTATCATTGCTGGCTATTCAGGG + Intergenic
1010325042 6:74554714-74554736 GTATCACTGCTGGTTATTCAGGG - Intergenic
1010328052 6:74587930-74587952 ATATCACTGCTGGTTATTCAAGG - Intergenic
1010528868 6:76942015-76942037 GTATAACTGCTGGTTATTCAGGG - Intergenic
1011033191 6:82944439-82944461 GTATCACTACTGGTTATTCAGGG - Intronic
1011291184 6:85779075-85779097 GTATCACTGCTGGTTATTCAGGG + Intergenic
1011901334 6:92302031-92302053 GTGTCACTGCTGGTTATTCAGGG - Intergenic
1012189487 6:96261909-96261931 GTATTACTGCTGGTTATTCAGGG - Intergenic
1012288426 6:97421909-97421931 GATTCACTGCTGGTTATTCAGGG + Intergenic
1013738441 6:113254994-113255016 GGTTCAGATCTGAATATTCATGG - Intergenic
1013781393 6:113732504-113732526 GGCTCACAACTGGATGTCCAAGG - Intergenic
1016061604 6:139636586-139636608 GAGTCACTGCTGGTTATTCAGGG + Intergenic
1016135197 6:140532384-140532406 GTATCACTGTTGGTTATTCAGGG - Intergenic
1016567451 6:145472241-145472263 GTATCACTGCTGGTTACTCAGGG - Intergenic
1017327652 6:153158509-153158531 GGTTCACAGATGGTTCTTCATGG - Intergenic
1017379635 6:153813666-153813688 GTATCACTGCTGATTATTCAAGG - Intergenic
1017387362 6:153901513-153901535 ATATCACAGTTGGTTATTCAGGG - Intergenic
1017568283 6:155712404-155712426 GACTCACAGCTGGATAATGATGG + Intergenic
1018535765 6:164817792-164817814 GTGTCACTGCTGGTTATTCATGG - Intergenic
1020514978 7:9106839-9106861 GTATCAGCGCTGGTTATTCAGGG - Intergenic
1021123719 7:16826240-16826262 CTATCACTGCTGAATATTCAGGG - Intronic
1021353727 7:19628255-19628277 GTATCACTGCTGGTTATTCAGGG - Intergenic
1021640952 7:22735674-22735696 GGATCGCTACTGGTTATTCAGGG - Intergenic
1022080195 7:27012629-27012651 GTATCACTACTGGTTATTCAGGG - Intergenic
1022514017 7:30964124-30964146 GGGTCTCAGCTGGCTACTCACGG - Exonic
1023185686 7:37530604-37530626 GGATCACACCTGGAGAAGCATGG + Intergenic
1023215905 7:37862430-37862452 GAATCACAGAAGCATATTCATGG + Intronic
1023939157 7:44759144-44759166 GTGTCACAGCAGGATCTTCAAGG + Intronic
1024415018 7:49096416-49096438 GTATCACTGCTGGTTATTCAGGG - Intergenic
1024498296 7:50071849-50071871 GTATCGCTGCTGGTTATTCAGGG - Intronic
1024683626 7:51720236-51720258 TGATAACACCTGGATTTTCAAGG - Intergenic
1024891661 7:54210855-54210877 GTATCACTGTTGGTTATTCAGGG - Intergenic
1028522036 7:91742427-91742449 GTATCATTGCTGGGTATTCAGGG + Intronic
1028548404 7:92028439-92028461 GGATCAGAGCAGTATATACAAGG + Intronic
1029178943 7:98685541-98685563 GGAACAGAGCTGGGCATTCAGGG - Intergenic
1030278887 7:107750018-107750040 GGATCATGGCTTGATATTCCAGG + Intronic
1031732617 7:125317003-125317025 GTATTACTGCTGGTTATTCAGGG - Intergenic
1033887240 7:145963739-145963761 GTATTGCTGCTGGATATTCAGGG - Intergenic
1034082942 7:148297371-148297393 GGCTCACAGATGAATATTGATGG + Intronic
1034434004 7:151054497-151054519 GGGCCACAGCTGCATCTTCAGGG + Intronic
1035084541 7:156247078-156247100 GTATCACTGCTGGTTATTCAGGG + Intergenic
1036936211 8:13004645-13004667 GTATCACCGCTGGTTATTCAGGG - Intronic
1037185881 8:16063228-16063250 GGATGACACCAAGATATTCATGG + Intergenic
1039647474 8:39303535-39303557 GTATCACTGCTGATTATTCAGGG + Intergenic
1041582891 8:59483268-59483290 GTGTCACTGCTGGTTATTCAGGG + Intergenic
1041852258 8:62404924-62404946 GTATCACTGCTGATTATTCAGGG + Intronic
1043312394 8:78876639-78876661 GTATCACTGCTGGTTATTCAGGG + Intergenic
1044395224 8:91703172-91703194 GTATCACTGCTAGTTATTCAGGG + Intergenic
1045592508 8:103613704-103613726 GTATCACTGCTGGTTATTCCGGG + Intronic
1045994900 8:108351546-108351568 GTATCACTGCTGGTTATTCAGGG - Intronic
1046169396 8:110485540-110485562 GTATCACTACTGGTTATTCAGGG - Intergenic
1048479526 8:134775563-134775585 AGATCAGAGCTGCATATTCATGG - Intergenic
1048646646 8:136428261-136428283 GTATCAGTGCTGGTTATTCAAGG - Intergenic
1050578758 9:7028256-7028278 GTATCACTGCTGGTTATTCAGGG + Intronic
1050949236 9:11566971-11566993 TTATCACTGCTGGCTATTCAGGG + Intergenic
1052258803 9:26491149-26491171 GTATCATTGCTGGTTATTCAGGG + Intergenic
1052420173 9:28233916-28233938 GTATTACTGCTGGTTATTCAGGG - Intronic
1055181233 9:73389048-73389070 GGACCACTGCTGGGCATTCATGG + Intergenic
1055387253 9:75775783-75775805 GTATCGCTGCTGGTTATTCAGGG - Intergenic
1055692328 9:78846092-78846114 GTATCACTGCTGGTTATTCAGGG + Intergenic
1056180350 9:84076639-84076661 GTATCACTGCTGGTTATTCAGGG - Intergenic
1058820875 9:108728311-108728333 GTATCACTGCTGATTATTCAAGG - Intergenic
1059778997 9:117507395-117507417 GGAGCACAGCTGCAAATGCATGG - Intergenic
1059936348 9:119315003-119315025 TGATCTCAGCTGGCTATTGAAGG - Intronic
1059978011 9:119738450-119738472 GGATCAGGGAAGGATATTCAAGG - Intergenic
1061915602 9:133751588-133751610 GTATCACTGCTGGTTATTGAGGG + Intergenic
1062159103 9:135069889-135069911 GAATCACAGCTGGACAAGCAGGG + Intergenic
1185457518 X:318346-318368 GGCTCATAGGTGGAGATTCAGGG - Intronic
1185588059 X:1255108-1255130 GGATTACAGCTGCATGTCCATGG + Intergenic
1187579345 X:20591872-20591894 GTATCACTGCTGGTTATTCAGGG + Intergenic
1187623558 X:21085809-21085831 GTATCACTGCTGGTTACTCAGGG - Intergenic
1187844902 X:23525021-23525043 GTATCACTGCTGCTTATTCAGGG - Intergenic
1187846240 X:23540932-23540954 GTATCACTGCTGGTTATTAAAGG - Intergenic
1188040578 X:25366561-25366583 GTATCACTGCTGGTTATTCAGGG + Intergenic
1188742990 X:33809215-33809237 GTATCACTGCTGGTTATTCAGGG + Intergenic
1188750017 X:33893544-33893566 GTATCACTGCTGGTTATTCAAGG + Intergenic
1188815322 X:34705699-34705721 GTATCATTGCTGGTTATTCAGGG + Intergenic
1188846319 X:35076671-35076693 GTATCACTGCTGGTTATTCAAGG + Intergenic
1188932076 X:36123954-36123976 GTATCACTGCTGGTTATTCAGGG + Intronic
1188943078 X:36263929-36263951 GTATTACTGCTGGTTATTCAGGG + Intronic
1189405707 X:40720975-40720997 GTATCGCCGCTGGTTATTCAGGG - Intronic
1189593823 X:42543442-42543464 GTATCACTGCTGGTTATTCAGGG - Intergenic
1189720969 X:43917305-43917327 AGCTCTCAGCTGGAAATTCAAGG + Intergenic
1189770080 X:44416848-44416870 GTATCGCTGCTGGTTATTCAAGG + Intergenic
1190530374 X:51368734-51368756 GTATCACTACTGGTTATTCATGG - Intergenic
1190537778 X:51446781-51446803 GCATCACTGCTGCTTATTCAGGG + Intergenic
1190893902 X:54597208-54597230 GCATCACTGCTGGTTATTCAGGG + Intergenic
1190919578 X:54839444-54839466 GTATCATAGCTGGTTATTCAGGG + Intergenic
1191123788 X:56932964-56932986 GTATCACTGCTGTTTATTCAGGG - Intergenic
1192135032 X:68589148-68589170 TTATCACTGCTGGTTATTCAGGG - Intergenic
1192380788 X:70614020-70614042 GGATCACTGCTGATTATTCATGG - Intronic
1192393383 X:70753921-70753943 CTATCACTGCTGGTTATTCAGGG - Intronic
1192841165 X:74857493-74857515 GTATCACTACTGGTTATTCAGGG - Intronic
1192863735 X:75107681-75107703 GTATCACTTCTGGTTATTCAGGG - Intronic
1193016379 X:76738544-76738566 GTATCACTGCTGATTATTCAAGG - Intergenic
1193078647 X:77382630-77382652 GTATCACTTCTGGTTATTCATGG - Intergenic
1193088376 X:77468024-77468046 GTATCACTTCTGGTTATTCAGGG - Intergenic
1193092543 X:77510268-77510290 GTACCACTGCTGGTTATTCAGGG - Intronic
1193116750 X:77782933-77782955 GGCTCTCTGCTGGTTATTCAGGG - Intronic
1193161908 X:78238025-78238047 GTATCACTGCTGGTTATTCACGG + Intergenic
1193204867 X:78736523-78736545 GTATCACTGCTGGTTATTCAGGG + Intergenic
1193287682 X:79732032-79732054 GTATTACTGCTGGTTATTCATGG - Intergenic
1193293416 X:79805500-79805522 GTATCACTGCTGGTTATTCAGGG + Intergenic
1193299985 X:79878560-79878582 GTATCACTGCTGGTTATTCAGGG - Intergenic
1193337394 X:80306821-80306843 GTATCGCTGCTGGTTATTCAAGG + Intergenic
1193417056 X:81238070-81238092 GAATCACTGTTGGTTATTCAGGG - Intronic
1193555790 X:82952051-82952073 GTATCACTGCTGGTTATTCTTGG + Intergenic
1193830958 X:86289050-86289072 GTATCACTGCTGGTTATTCAGGG + Intronic
1193856616 X:86611082-86611104 GTATCACTGCTGGTTATTCAGGG + Intronic
1193957944 X:87885941-87885963 GTATCACTGCTGGTTTTTCAGGG + Intergenic
1193986829 X:88252790-88252812 GTATCACTGCTAGTTATTCAGGG + Intergenic
1194223615 X:91227383-91227405 GTATCACTGCTGGTTATTCAGGG - Intergenic
1194253162 X:91602961-91602983 GTATTACTGCTGGATACTCAGGG - Intergenic
1194307000 X:92259761-92259783 GTATCACTGCTGGTTATTCAGGG + Intronic
1194348282 X:92793509-92793531 GTATCCCTGCTGGTTATTCAAGG - Intergenic
1194361048 X:92950676-92950698 GTATCACTGCTGGTAATTCAAGG + Intergenic
1194393213 X:93346731-93346753 GTATCACTGCTGGTTATTCAGGG + Intergenic
1194476862 X:94369314-94369336 GTATCACTGCTGGTTACTCAGGG - Intergenic
1194506780 X:94743390-94743412 GTATCGCTGCTGGTTATTCAGGG + Intergenic
1194546370 X:95239746-95239768 GTATCACTGCTGGTTACTCAGGG - Intergenic
1194568420 X:95522420-95522442 GTATCACTGCTGATTATTCAGGG - Intergenic
1194583590 X:95705763-95705785 GCATTACTGCTGGTTATTCAGGG - Intergenic
1194591515 X:95805347-95805369 GTATCACTGCTGGTTATTTAGGG - Intergenic
1194795856 X:98210563-98210585 GCATCACTGCTGGTTATTCAGGG - Intergenic
1194928791 X:99862004-99862026 TTATCACTGCTGGTTATTCAGGG - Intergenic
1194990646 X:100543466-100543488 GGATTGCTGCTGGTTATTCAGGG - Intergenic
1195172302 X:102281363-102281385 GCATCACTGCTGGTTATTCAGGG + Intergenic
1195186558 X:102405730-102405752 GCATCACTGCTGGTTATTCAGGG - Intronic
1195199336 X:102532770-102532792 GTATCACTGCTGGTTATTAACGG - Intergenic
1195594538 X:106673295-106673317 GTATCACTGCGGGTTATTCAGGG + Intronic
1195872119 X:109497534-109497556 GTATCACTGTTGGTTATTCAGGG + Intergenic
1196154009 X:112406981-112407003 GTATCACTGCTGATTATTCAGGG - Intergenic
1196215841 X:113050671-113050693 GTATCACTGCTGGTTATTCAGGG - Intergenic
1196498060 X:116346147-116346169 GTATCGCTGCTGGTTATTCAGGG + Intergenic
1196980611 X:121209418-121209440 GTATCACTGCTGGTTATTGAGGG + Intergenic
1197052588 X:122077588-122077610 GTATCTCTGCTGGCTATTCAGGG + Intergenic
1197083919 X:122450750-122450772 GGCTCACACCTGGAATTTCAGGG + Intergenic
1197520402 X:127490259-127490281 GTATCGCTGCTGGTTATTCAGGG + Intergenic
1197558847 X:127992419-127992441 GTATGACTGCTGGTTATTCAGGG - Intergenic
1197602641 X:128548237-128548259 GTATCACTGCTGATTATTCAGGG + Intergenic
1197661550 X:129179127-129179149 TGATAACTGCTGGTTATTCACGG + Intergenic
1197676373 X:129335028-129335050 GTATCGCTGCTGGTTATTCAGGG - Intergenic
1198190473 X:134299509-134299531 GTATCACTGCTGGTTATTCAGGG - Intergenic
1198512225 X:137363820-137363842 GGATGATAGCTGGATACTGAAGG + Intergenic
1198664107 X:139002856-139002878 GTATCACTACTGGTTATTCAGGG - Intronic
1198694857 X:139324928-139324950 GTATCACTGCTGCTTATTCAGGG - Intergenic
1198724692 X:139664841-139664863 GTATCACAGCTGGTTATTCAGGG + Intronic
1198818092 X:140614513-140614535 GTATCACTGCTGGTTATTCAGGG + Intergenic
1198995242 X:142566902-142566924 ATATCACTGCTGGTTATTCAGGG + Intergenic
1199032225 X:143013849-143013871 GTATCACTGCTGGTTATTCAAGG - Intergenic
1199173543 X:144758403-144758425 GTATCACTGCTAGTTATTCAGGG - Intergenic
1199191805 X:144980124-144980146 GTATCACTGCTGGCTATTCAGGG - Intergenic
1199197468 X:145048122-145048144 GTATTACTGCTGGCTATTCAGGG - Intergenic
1199246057 X:145605098-145605120 ATATCACAGCGGGTTATTCATGG - Intergenic
1199247656 X:145625463-145625485 GTATCACTGCTGGTTATTCAGGG - Intergenic
1199258537 X:145744701-145744723 GTATCACTGTTGGTTATTCAGGG - Intergenic
1199274614 X:145926462-145926484 CTATCACTGCTGGTTATTCAGGG - Intergenic
1199317340 X:146395916-146395938 GTATCACATCTGGTTATTCAGGG + Intergenic
1199334344 X:146600746-146600768 GTATCACTGCTGGTTTTTCAGGG + Intergenic
1199374276 X:147088582-147088604 GTATCGCTGCTGGTTATTCAGGG + Intergenic
1199455213 X:148020562-148020584 GTATCACTGCTTGTTATTCAGGG + Intronic
1199908439 X:152259713-152259735 GTATCACTGCTGGTTATTCAGGG - Intronic
1200370503 X:155719795-155719817 GGATTACTGCTGATTATTCAGGG - Intergenic
1200560081 Y:4690765-4690787 GTATCATTGCTGGTTATTCAGGG - Intergenic
1200572102 Y:4844204-4844226 GTATTACTGCTGGATACTCAGGG - Intergenic
1200656609 Y:5910138-5910160 GTATCCCTGCTGGTTATTCAAGG - Intergenic
1201955880 Y:19621930-19621952 GTATCTCTGCTGGTTATTCAAGG - Intergenic
1202035759 Y:20633320-20633342 GTGTCACTGCTGGTTATTCAGGG + Intergenic
1202341281 Y:23871436-23871458 GGCTCTCATCTGGAAATTCATGG + Intergenic
1202529485 Y:25798650-25798672 GGCTCTCATCTGGAAATTCATGG - Intergenic