ID: 1072946174

View in Genome Browser
Species Human (GRCh38)
Location 10:99811835-99811857
Sequence TGTCTTCATGGGATCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 202}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072946174_1072946178 1 Left 1072946174 10:99811835-99811857 CCAGCTGTGATCCCATGAAGACA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG No data
1072946174_1072946180 18 Left 1072946174 10:99811835-99811857 CCAGCTGTGATCCCATGAAGACA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1072946180 10:99811876-99811898 GGATGGAGGTAGTGCAGCGTTGG No data
1072946174_1072946183 29 Left 1072946174 10:99811835-99811857 CCAGCTGTGATCCCATGAAGACA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1072946183 10:99811887-99811909 GTGCAGCGTTGGCAGGTGGCCGG No data
1072946174_1072946182 25 Left 1072946174 10:99811835-99811857 CCAGCTGTGATCCCATGAAGACA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1072946182 10:99811883-99811905 GGTAGTGCAGCGTTGGCAGGTGG No data
1072946174_1072946177 -3 Left 1072946174 10:99811835-99811857 CCAGCTGTGATCCCATGAAGACA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1072946177 10:99811855-99811877 ACATTTGTGTGTGCAGATTGTGG No data
1072946174_1072946181 22 Left 1072946174 10:99811835-99811857 CCAGCTGTGATCCCATGAAGACA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1072946181 10:99811880-99811902 GGAGGTAGTGCAGCGTTGGCAGG No data
1072946174_1072946179 4 Left 1072946174 10:99811835-99811857 CCAGCTGTGATCCCATGAAGACA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1072946179 10:99811862-99811884 TGTGTGCAGATTGTGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072946174 Original CRISPR TGTCTTCATGGGATCACAGC TGG (reversed) Intronic
902046399 1:13527969-13527991 TGTCCTCATGAGGTCACATCTGG - Intergenic
902698336 1:18155201-18155223 TGCCTTCAAGGGGTCACAGCTGG - Intronic
905038981 1:34937640-34937662 TGTCTTCATGACATGGCAGCTGG - Intergenic
907047059 1:51305808-51305830 AGCCTTCAGGGGCTCACAGCTGG - Intronic
909131516 1:71742648-71742670 TGTTTTCATGGGCTCATAGCTGG + Intronic
912385143 1:109267746-109267768 TGTGTTCCTGGGCTCCCAGCTGG + Intronic
912857027 1:113178321-113178343 TGTTGTCATGGGTGCACAGCTGG - Intergenic
915445751 1:155973932-155973954 TGGCTTCCTGGGCTCCCAGCAGG + Intronic
917816815 1:178719553-178719575 TGTCTTCGGGGAATCACATCTGG + Intergenic
918134493 1:181659439-181659461 TGTCTCCATGGAAACAAAGCAGG + Intronic
919760300 1:201093871-201093893 TGTCTTCCTGGGGTGAGAGCTGG - Exonic
920897057 1:210063714-210063736 TGTCTTCATTTGGCCACAGCTGG + Intronic
920979479 1:210819906-210819928 TGTCTTCATGGCATGACCACTGG - Intronic
921003282 1:211067058-211067080 TCTCTCCATGGGATTACTGCGGG - Intronic
922519020 1:226230433-226230455 TGCCTTCATGTGTTGACAGCAGG - Intergenic
923518359 1:234716549-234716571 TGTCTCTCTGGGATCACAGACGG - Intergenic
1063961485 10:11309687-11309709 AGTCCTCCTGGGATCAGAGCAGG - Intronic
1068065053 10:52120474-52120496 TGATTTCATAGGCTCACAGCTGG - Intronic
1069391099 10:67935985-67936007 TGTCTTCAAGGGATTTCAGGAGG + Intronic
1069992207 10:72322740-72322762 TGCCTTCCTGGGATCACCTCAGG + Intergenic
1070358956 10:75668523-75668545 TGTCTTCATGGCATTACACTTGG - Intronic
1072855688 10:98943674-98943696 TGTCCTCATGATATGACAGCTGG - Intronic
1072946174 10:99811835-99811857 TGTCTTCATGGGATCACAGCTGG - Intronic
1075700468 10:124466311-124466333 TGTCTTTATGCAAACACAGCAGG - Intronic
1075826012 10:125357542-125357564 TGTCTTAATTGGATGGCAGCAGG + Intergenic
1078168934 11:8913565-8913587 TGTCTTCTAGGAATTACAGCAGG + Intronic
1080210217 11:29777373-29777395 TGTCCTCATGGCATGACAACTGG - Intergenic
1080607043 11:33871938-33871960 TGTCAACCTGGGCTCACAGCAGG + Intronic
1084470850 11:69358063-69358085 TGCCTTTATGGGCTCACAGTTGG - Intronic
1084600822 11:70144493-70144515 GGTCTACATGGGATCTCATCAGG - Intronic
1084678235 11:70649339-70649361 TGATTTCATGAGACCACAGCGGG + Intronic
1085335392 11:75689745-75689767 TATCTTCATGACATCAGAGCAGG - Intergenic
1085884006 11:80500702-80500724 TGATTTCATAGGCTCACAGCTGG + Intergenic
1086623192 11:88913325-88913347 TGCCTTCTTGGGCTCAGAGCAGG - Intronic
1089324001 11:117644822-117644844 TGTGGTCAAGGGATCTCAGCAGG + Intronic
1090131829 11:124150760-124150782 TGTCTTCATGTGGCCAAAGCAGG + Intergenic
1090729274 11:129555651-129555673 TGATTTCATAGGCTCACAGCTGG + Intergenic
1090925273 11:131244119-131244141 TGTCTTCTTGGGCCGACAGCTGG + Intergenic
1091092228 11:132782270-132782292 TGTCTCCATGGAAACCCAGCTGG - Intronic
1091554023 12:1558460-1558482 TGATTTCATGGGTTCACAGCTGG - Intronic
1092942056 12:13419225-13419247 TCTATTCATGGGAGCTCAGCAGG - Intergenic
1093945080 12:25099106-25099128 TGACTGCAAGGGATCACAGGGGG - Intronic
1095811825 12:46380306-46380328 TGTCTTCATGACATGGCAGCTGG + Intergenic
1098791317 12:74827725-74827747 TCTTTTCATGGTATCAAAGCAGG - Intergenic
1098962761 12:76756084-76756106 TGTCTTCATGATATGGCAGCTGG + Intergenic
1102476673 12:113193047-113193069 TGTTTGCATGAGAGCACAGCTGG - Intergenic
1102612299 12:114123028-114123050 TGTCTCCCAGGGGTCACAGCTGG + Intergenic
1102632844 12:114296942-114296964 TGTCTTCATGACATGACAGCTGG - Intergenic
1103882943 12:124180379-124180401 TGGTTTCACGGGTTCACAGCCGG + Intronic
1104902376 12:132196475-132196497 TGTCTTCCTGGGAGCCGAGCTGG - Exonic
1105661610 13:22501935-22501957 TGTCTTCATGCTACCACAGCAGG - Intergenic
1108691219 13:52860996-52861018 TGTCTTCAAGGGCTCTCAGCTGG + Intergenic
1109873785 13:68371130-68371152 TGTTTTCATGGGAGCACAATTGG - Intergenic
1109922583 13:69088271-69088293 TGACTTCACAGGCTCACAGCTGG + Intergenic
1111494905 13:89034950-89034972 TGTCTTTATAGGATCATAGGTGG + Intergenic
1113802387 13:113093333-113093355 TGCCTTCTTGGGGTCACAGCTGG - Intronic
1113803890 13:113102381-113102403 TGCCTTCTTGGGGCCACAGCTGG - Intergenic
1117791113 14:59343168-59343190 TGTATCCATGGGATCAGAACTGG + Intronic
1119514984 14:75240898-75240920 GGTCTTCGTAGAATCACAGCTGG - Intronic
1119583948 14:75814361-75814383 TCTCTTCATTTGATCAGAGCTGG + Intronic
1120838194 14:89059897-89059919 TGTCTTCAAGGTTTCACACCGGG + Intergenic
1121092638 14:91193403-91193425 TGTCCTCATGGGAGCTCAGAGGG + Intronic
1121382809 14:93489439-93489461 TGATTTCATAGGCTCACAGCTGG - Intronic
1122843599 14:104478631-104478653 CCTCTTCATAGGATCCCAGCAGG + Intronic
1123905017 15:24912352-24912374 TGACTTCACAGGTTCACAGCTGG + Intronic
1127547250 15:60003202-60003224 TGTCTTAGTGGGATCGCAGGCGG + Intergenic
1130161203 15:81402243-81402265 TAACTTCATGGGTTCAAAGCTGG + Intergenic
1130426961 15:83811059-83811081 TATCTTCCTGTGACCACAGCTGG + Intronic
1131436405 15:92426166-92426188 TTACTTCATGGAATCACAGATGG - Intronic
1131856792 15:96605855-96605877 CATCTTCATGGGCACACAGCCGG - Intergenic
1134435879 16:14256534-14256556 TGTCCACATGGCATGACAGCTGG - Intronic
1134607650 16:15583674-15583696 TTTCAGCATGGGATGACAGCAGG + Intronic
1135761848 16:25144210-25144232 TGGCTGCATGGGCACACAGCAGG + Intronic
1138730044 16:59184484-59184506 TGGCTTCATGGGTTCACAGCTGG - Intergenic
1139252674 16:65510992-65511014 TTTCTGCCTGGGAACACAGCCGG - Intergenic
1139803946 16:69547816-69547838 TGTCTTTATGGCATCAGAACAGG - Intergenic
1143809835 17:9462295-9462317 TGTCTTCATTAGATCACTCCAGG - Intronic
1144189115 17:12827303-12827325 TGTTTACATGGCATCACAGAAGG - Intronic
1144551800 17:16247400-16247422 TGTTTTCACAGGTTCACAGCTGG - Intronic
1144942492 17:18951519-18951541 TGTCTGCCTGGGACCACAGAGGG - Intronic
1147136182 17:38435373-38435395 TCTTTTCATGGAATCACCGCAGG - Intronic
1148546030 17:48519748-48519770 TATCTTCCTGGAAGCACAGCAGG - Intergenic
1149026941 17:52037660-52037682 TGTCATCTGGGGATCACAGAGGG - Intronic
1151625621 17:75273672-75273694 TGTGTTGATGGGAGCAGAGCGGG - Intronic
1153575063 18:6511911-6511933 TGTCTTCATTGAATGACATCAGG + Intronic
1154170127 18:12045592-12045614 TGGTTTCACAGGATCACAGCTGG - Intergenic
1155797954 18:30064356-30064378 TAATTTCATGGGTTCACAGCTGG - Intergenic
1157134027 18:45036662-45036684 TTTGTTCATGGTATCACAACTGG + Intronic
1157371280 18:47114508-47114530 TGTCTTGATGGGAAAACAGCTGG - Intronic
1159197119 18:65131748-65131770 TGTCTTTATGGCATGGCAGCTGG + Intergenic
1160130328 18:76219454-76219476 TGTTTTCAGGGGATTAGAGCAGG - Intergenic
1160468864 18:79108168-79108190 AGTCTGCATGGCACCACAGCAGG + Intronic
1164556481 19:29256652-29256674 TGGGTTCACTGGATCACAGCTGG - Intergenic
1164571892 19:29380705-29380727 CGTCATCATGGAATCACAGGTGG - Intergenic
1165731946 19:38151603-38151625 AGTCCTCCTTGGATCACAGCCGG - Intronic
1165838672 19:38774039-38774061 TGGCTTCATGGGTTCACAGGGGG + Intergenic
1168099154 19:54131845-54131867 TCTCGTCATGGGATCCCAGAAGG + Intergenic
925755621 2:7128938-7128960 TTTCTTCATGGGAAAACAGTAGG - Intergenic
925925107 2:8664666-8664688 CGTCTTCATGGAATGAGAGCTGG + Intergenic
929586268 2:43116776-43116798 TGGTTTCATAGGTTCACAGCTGG - Intergenic
930239437 2:48921154-48921176 TGATTTCATAGGCTCACAGCTGG - Intergenic
931487623 2:62708712-62708734 TGGCTTCCTGGGATCTGAGCTGG + Intronic
934891343 2:98072743-98072765 TCTCTTCCTGGGCACACAGCTGG + Intergenic
938160676 2:128982175-128982197 TGGCTTCAAAGGTTCACAGCTGG + Intergenic
939520469 2:143223783-143223805 TGTCTCCATGGTCTCTCAGCAGG - Intronic
939964388 2:148596274-148596296 TGTCCTCATGACATGACAGCTGG + Intergenic
941268151 2:163390008-163390030 TGTCCGCATGGTATCTCAGCTGG + Intergenic
942772507 2:179539194-179539216 TGTCTTCCTGGGCTTGCAGCTGG + Intronic
943170386 2:184390025-184390047 TTTCTTCATGGGTTCAAACCTGG - Intergenic
946289980 2:218737373-218737395 TGCCCTCATAGGATCAAAGCTGG - Intronic
947688227 2:232109803-232109825 TGTCTTCATGAAATCATTGCTGG - Intronic
948791962 2:240383781-240383803 CGTCTTCAGGGACTCACAGCTGG - Intergenic
1170394998 20:15916286-15916308 TGTCCTCATGAGATGGCAGCTGG + Intronic
1172784783 20:37460625-37460647 TGTCTTCAGGGCATGGCAGCTGG + Intergenic
1175086555 20:56464323-56464345 TCTCTTCATGTGTTCCCAGCTGG - Intergenic
1176984358 21:15419393-15419415 TATACTCTTGGGATCACAGCAGG - Intergenic
1178102377 21:29283664-29283686 TGTCTTCATATGTTCAGAGCAGG + Intronic
1184286446 22:43474406-43474428 TGTCTTCATCAGATCAAAGGAGG - Intronic
950731690 3:14965068-14965090 TGTCTGCATGGGTTCTCTGCAGG - Intronic
951796005 3:26539124-26539146 TGTCTTCAGGGACTCTCAGCAGG - Intergenic
953616302 3:44493587-44493609 TGGTTTCATAGGTTCACAGCTGG + Intergenic
954418096 3:50403948-50403970 TGCCTTCAAGGGACCACATCTGG - Intronic
954990378 3:54835918-54835940 TGTCTTCATGGCAACAGTGCTGG + Intronic
959348224 3:105226762-105226784 TGTCTTCATTGTACCAAAGCAGG - Intergenic
959690828 3:109196082-109196104 TGTATTCATGGTATCACTGGTGG - Intergenic
960055740 3:113275120-113275142 TGTTTTCCTGGCATTACAGCTGG - Intronic
963552306 3:146739649-146739671 TGTGTTCATGGGGTCACGACAGG - Intergenic
963866540 3:150368091-150368113 TGTCTTCATGAGATGGCAGCTGG + Intergenic
964465777 3:156990263-156990285 TGTCCTCAGGGCATCACATCTGG + Intronic
966208319 3:177427262-177427284 CGTCTTCATGATATGACAGCTGG + Intergenic
966527860 3:180940093-180940115 TGTCTTCTTGGGTCCACTGCTGG - Intronic
966965920 3:184993584-184993606 TGGCTAAATGGGATCACAGGAGG + Intronic
967074233 3:185987836-185987858 TGTCTTCTTTGGTACACAGCTGG + Intergenic
969447688 4:7254903-7254925 GGACCTCATGGGAACACAGCCGG - Intronic
969522159 4:7684759-7684781 TGTCTTCCTGGGATTCCACCTGG + Intronic
970027230 4:11636478-11636500 TGTATTCATGGAATCTAAGCTGG + Intergenic
971360684 4:25935466-25935488 TGTGTTCAGGTGATCACAGCTGG - Intergenic
972304182 4:37816114-37816136 TGTGTTCATGTGACCACAGCAGG + Intergenic
974132399 4:57772825-57772847 CCTCTTCCTGGGAACACAGCTGG + Intergenic
975574511 4:75849527-75849549 TGTCTGCATGGGCACACAGTAGG - Intergenic
977024528 4:91799224-91799246 TGCTTTCATAGGATCAAAGCAGG - Intergenic
977544926 4:98366286-98366308 TGTCTTCAATGGATGGCAGCAGG - Intronic
977613577 4:99062247-99062269 TGACCTCCTGGGTTCACAGCTGG - Exonic
978706678 4:111721314-111721336 TGTGTTCATGGGTTCCCGGCAGG - Intergenic
979027474 4:115595986-115596008 TCACTTCATGTGGTCACAGCAGG - Intergenic
981007453 4:139890310-139890332 TGTCTCCATGGGATCTCCCCAGG - Exonic
982064107 4:151637339-151637361 TGCCTTCAAGGGACAACAGCAGG + Intronic
983210766 4:164955669-164955691 TGTCTTCATGTGACCACAAAAGG + Intronic
983266615 4:165514146-165514168 TGTCTTAATGGGATCACGTTGGG + Intergenic
984761250 4:183364719-183364741 TTTCTTCATGGGGTCTCAGGAGG - Intergenic
985024152 4:185722900-185722922 TGTATTCATGTCATCACAGTGGG + Intronic
985244991 4:187971342-187971364 TGTTTTCATGGAATTGCAGCAGG - Intergenic
985969313 5:3362513-3362535 TGTCTCCCTGTGTTCACAGCAGG + Intergenic
985990715 5:3558392-3558414 TGTCTTCACCAGGTCACAGCCGG + Intergenic
987814673 5:22884683-22884705 TGTTTTCACAGGTTCACAGCTGG + Intergenic
989011647 5:36877665-36877687 TCCCTTCATGGGGTCACAGGGGG - Intronic
990205094 5:53420185-53420207 TGTCCTCATGACATCGCAGCTGG + Intergenic
990324146 5:54658092-54658114 TGTCCTCATGACATGACAGCTGG - Intergenic
990718890 5:58670731-58670753 TGTCTGCTTTGGATGACAGCTGG + Intronic
990992962 5:61702965-61702987 AGGCTTCATGGCCTCACAGCTGG + Intronic
991617521 5:68512455-68512477 GGTCATCATTGGATTACAGCTGG + Intergenic
992415614 5:76550113-76550135 TGGTTTCACGGGTTCACAGCTGG - Intronic
995495884 5:112742648-112742670 TGTCTTCATGACATAGCAGCTGG + Intronic
996334599 5:122369041-122369063 TGCCTTCTTGAGATCAGAGCTGG - Intronic
997690086 5:135822417-135822439 TTTCTTCTTGGGGTCTCAGCAGG + Intergenic
998198982 5:140103298-140103320 TGTCTTCATGAGGTCAGTGCTGG + Intergenic
998550909 5:143077363-143077385 TATCTTCATAGGATTACAGATGG + Intronic
1004307372 6:14513174-14513196 TGTCTTCATGACATGACAACTGG + Intergenic
1005096127 6:22118482-22118504 TTTCTTCCTAGGATCACTGCAGG + Intergenic
1006718136 6:36132940-36132962 TGTCTTCATGGTGTTAAAGCTGG - Intronic
1007878474 6:45134578-45134600 TGTTTTCATAGGCTCACAGCTGG - Intronic
1008279157 6:49575041-49575063 TGTCTTTTTGGTAACACAGCAGG - Intergenic
1009357554 6:62770037-62770059 TGGTTTCATAGGTTCACAGCTGG + Intergenic
1017618379 6:156269476-156269498 TGCCCTCATGGGCTCACAGCTGG - Intergenic
1018714551 6:166521587-166521609 TGTTTTCATAGGCTCACAGCTGG + Intronic
1020430071 7:8109754-8109776 TGACTTCATGGAATCACAAAAGG - Intergenic
1020457603 7:8391723-8391745 AGTCTAAATGGGATCTCAGCAGG - Intergenic
1021903026 7:25306384-25306406 TTTCTTCATGGGATCCTAGCAGG + Intergenic
1022206841 7:28173033-28173055 GGCCTTCATGGGATCATAACTGG - Intronic
1022688241 7:32616932-32616954 TGTCATCATGACATGACAGCTGG + Intergenic
1023127085 7:36965198-36965220 TGTATTCATGGCATCATGGCTGG + Intronic
1025170038 7:56748314-56748336 TGGCTTCATGGGAGAACAGAGGG - Intergenic
1025701847 7:63827404-63827426 TGGCTTCATGGGAGAACAGAGGG + Intergenic
1028776880 7:94687674-94687696 TGATTTCATAGGCTCACAGCTGG - Intergenic
1029853778 7:103492152-103492174 TGTATTCTTGGTATCCCAGCAGG - Intronic
1030011750 7:105175968-105175990 TGGCTTCATAGGATCAAAACTGG - Intronic
1032339449 7:131057414-131057436 TGTTTTCATGTGCTGACAGCCGG - Intergenic
1033012082 7:137633610-137633632 TGGTTTTATGGGATCTCAGCTGG - Intronic
1034907695 7:154965171-154965193 TGTCTTCACAGCATGACAGCTGG - Intronic
1036918132 8:12824784-12824806 TGTCTTCATGATATGATAGCTGG - Intergenic
1039580305 8:38660603-38660625 TGACTTCATGGGAGCACAGTTGG + Intergenic
1040548937 8:48423595-48423617 TGGTTTCATGGGCTCCCAGCTGG - Intergenic
1041370502 8:57154717-57154739 TCTCTTCCTAGGATCACAGGTGG - Intergenic
1041523600 8:58781358-58781380 TGTCTTCTTGGGATTAGAGAAGG - Intergenic
1041808448 8:61881558-61881580 TTTCTTCAGGGGAGCACAGAAGG + Intergenic
1043649665 8:82575602-82575624 TGTTTTCACAGGTTCACAGCTGG - Intergenic
1044173495 8:89086943-89086965 TGTCTGCATGGTAGCACTGCTGG + Intergenic
1048828466 8:138452880-138452902 TGTCCTCATGGCATGACAGTTGG + Intronic
1052901623 9:33798721-33798743 TTTCTCCATGGGAGCACTGCAGG - Intronic
1052996849 9:34555744-34555766 TGTCCTCAAGGGCTCACAGATGG - Intronic
1053731019 9:41056971-41056993 TGTCTTCATGACATGGCAGCTGG - Intergenic
1053879138 9:42574843-42574865 TGACTTTATGGGCTCATAGCTGG - Intergenic
1053893527 9:42719511-42719533 TGACTTTATGGGCTCATAGCTGG + Intergenic
1054232552 9:62526854-62526876 TGACTTTATGGGCTCATAGCTGG + Intergenic
1056451349 9:86719952-86719974 TGTCTTCATGACATGGCAGCTGG + Intergenic
1056535246 9:87521471-87521493 TGTCCTCATGGGATAAGAACTGG - Intronic
1059231510 9:112725534-112725556 TGATTTCACAGGATCACAGCTGG - Intergenic
1059772449 9:117440383-117440405 TGTCTTCATGACATGGCAGCTGG - Intergenic
1060914202 9:127375810-127375832 TGTCCTCAGGACATCACAGCTGG - Intronic
1061712974 9:132500179-132500201 TGTCTTCATGGAGTGACAGATGG + Intronic
1062725337 9:138070168-138070190 TGGCTTGATGGGGACACAGCAGG - Intronic
1187573436 X:20529461-20529483 TGCCTTCTTGGTCTCACAGCTGG + Intergenic
1189388052 X:40553769-40553791 TGTCTTCAGGGGGCCACAGCAGG - Intergenic
1190435030 X:50415782-50415804 TGACTTCATAGGTTCACAGCTGG + Intronic
1190496765 X:51034009-51034031 GGTCTCCAGGGGATGACAGCAGG + Intergenic
1190509204 X:51159928-51159950 GGTCTCCAGGGGATGACAGCAGG - Intergenic
1194372182 X:93087950-93087972 TGTCTTCATGTGGCCAGAGCAGG - Intergenic
1194790240 X:98139171-98139193 TGTCTTCATGACATGACAGCTGG - Intergenic
1196578707 X:117353604-117353626 TGTACAAATGGGATCACAGCAGG - Intergenic
1197214697 X:123857181-123857203 TATCTTCATGACATGACAGCTGG + Intergenic
1197342468 X:125289345-125289367 TGATTTCATAGGGTCACAGCTGG + Intergenic
1199555668 X:149105801-149105823 CCTCTTCATGGGATGACAGGAGG + Intergenic
1200921987 Y:8621409-8621431 TCTCTTCCTGGGTTCACTGCAGG - Intergenic
1201683717 Y:16678320-16678342 TGTCTTCATGGTATCAAAATTGG + Intergenic