ID: 1072946175

View in Genome Browser
Species Human (GRCh38)
Location 10:99811846-99811868
Sequence GCACACACAAATGTCTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 236}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072946175_1072946181 11 Left 1072946175 10:99811846-99811868 CCCATGAAGACATTTGTGTGTGC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1072946181 10:99811880-99811902 GGAGGTAGTGCAGCGTTGGCAGG No data
1072946175_1072946178 -10 Left 1072946175 10:99811846-99811868 CCCATGAAGACATTTGTGTGTGC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG No data
1072946175_1072946183 18 Left 1072946175 10:99811846-99811868 CCCATGAAGACATTTGTGTGTGC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1072946183 10:99811887-99811909 GTGCAGCGTTGGCAGGTGGCCGG No data
1072946175_1072946184 27 Left 1072946175 10:99811846-99811868 CCCATGAAGACATTTGTGTGTGC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1072946184 10:99811896-99811918 TGGCAGGTGGCCGGCGTCTCTGG No data
1072946175_1072946179 -7 Left 1072946175 10:99811846-99811868 CCCATGAAGACATTTGTGTGTGC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1072946179 10:99811862-99811884 TGTGTGCAGATTGTGGATGGAGG No data
1072946175_1072946180 7 Left 1072946175 10:99811846-99811868 CCCATGAAGACATTTGTGTGTGC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1072946180 10:99811876-99811898 GGATGGAGGTAGTGCAGCGTTGG No data
1072946175_1072946185 28 Left 1072946175 10:99811846-99811868 CCCATGAAGACATTTGTGTGTGC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1072946185 10:99811897-99811919 GGCAGGTGGCCGGCGTCTCTGGG No data
1072946175_1072946182 14 Left 1072946175 10:99811846-99811868 CCCATGAAGACATTTGTGTGTGC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1072946182 10:99811883-99811905 GGTAGTGCAGCGTTGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072946175 Original CRISPR GCACACACAAATGTCTTCAT GGG (reversed) Intronic
901464840 1:9414586-9414608 TTACACCCAAATGTCTTCATAGG - Intergenic
903092175 1:20930996-20931018 GCACCCACAAATGTTTTTAATGG + Intronic
904542536 1:31242810-31242832 GAAGACACAATTGGCTTCATGGG - Intergenic
904568442 1:31442656-31442678 GCAAACACAAATGACTTCATGGG - Intergenic
905756637 1:40515584-40515606 CCACTCACAAATGTCTGCATAGG - Exonic
906307877 1:44732169-44732191 GGTCACACGAAGGTCTTCATGGG - Intergenic
906342743 1:44995106-44995128 GCACACAGAATTTTCTTCATTGG + Intergenic
906555939 1:46713788-46713810 GCACAGACAGGTGTCTTCAGTGG + Intronic
908052350 1:60247023-60247045 GCCCACACAGATGGCCTCATGGG + Intergenic
912403902 1:109420278-109420300 CCACACACAATTGTCTTCTGAGG - Intronic
912722178 1:112029340-112029362 GCACACACAAATGTACTCCTTGG + Intergenic
913156918 1:116108702-116108724 CCAAACACAAATGCCTACATAGG - Intergenic
916020871 1:160791073-160791095 GCACATAAAAATTTATTCATAGG + Intergenic
919136087 1:193509505-193509527 GGCCACATAAATGTCTTCCTTGG + Intergenic
919526726 1:198662820-198662842 TCACACTTAAATGTTTTCATAGG + Intronic
920573749 1:207039880-207039902 GAACAGACAAATGTCTCCAGAGG - Intronic
922093941 1:222424842-222424864 GCACACACATATGCATTTATTGG + Intergenic
923060770 1:230471414-230471436 GGTCACATAAATGTCTTCTTTGG + Intergenic
1063904332 10:10766854-10766876 CCACTCACACATGTCTTCCTTGG + Intergenic
1063946608 10:11182264-11182286 GCAAACAGAAATGACTTCATAGG + Intronic
1065048365 10:21765133-21765155 GCCCACAGAAATAACTTCATTGG + Intronic
1065689171 10:28315528-28315550 GCAAACTCAAATGTCTGCAGTGG - Intronic
1066257156 10:33691108-33691130 GCCCACAAAAATATCTTCTTTGG + Intergenic
1068037130 10:51774890-51774912 CCAAACACAAATGTCTTAAAAGG - Intronic
1069761373 10:70813950-70813972 ACACACACACAGGGCTTCATCGG + Intergenic
1072368231 10:94736549-94736571 ACACGCACATATGTCTGCATAGG + Intronic
1072889327 10:99307860-99307882 ACACACACAAATGGCTACAGTGG + Intergenic
1072910409 10:99496040-99496062 GCAAACTCAAATGCCTTCAGGGG + Intergenic
1072946175 10:99811846-99811868 GCACACACAAATGTCTTCATGGG - Intronic
1073456403 10:103639276-103639298 GCTCACTCTAATGGCTTCATAGG + Intronic
1075171771 10:120122037-120122059 GGACAGACCAAGGTCTTCATTGG - Intergenic
1075447324 10:122522239-122522261 TCCCACACAAATGACTTCCTTGG - Intergenic
1075536532 10:123276377-123276399 GCAATCACAAGTGTCCTCATAGG + Intergenic
1076260015 10:129057964-129057986 GCACACACAAGTGTCCTGAGAGG - Intergenic
1076308344 10:129481544-129481566 TCAAACACAAATGGCTTCACTGG - Intronic
1079825566 11:25187746-25187768 GCACATACATATTTCTTCATTGG - Intergenic
1080151215 11:29054544-29054566 GGCCACATAAATGTCTTCTTTGG + Intergenic
1080800685 11:35607374-35607396 CCACACACAAACATCTTCTTGGG + Intergenic
1081856369 11:46306528-46306550 GCACATACAAAACTCTTCAGCGG + Intronic
1082118581 11:48354940-48354962 GCACCCACAAATGTCATTAGTGG + Intergenic
1084788656 11:71459176-71459198 GCACACACAAAGGCCTCCACAGG - Intronic
1084788696 11:71459400-71459422 GCACACACAGAGGCCTCCATAGG - Intronic
1085338212 11:75713723-75713745 GCACACCCAAATGTCTCAAACGG + Intergenic
1086071048 11:82799673-82799695 GCCCAAACAAATGTCTACACAGG - Intergenic
1087165587 11:94999196-94999218 TCACACACAAATGTGTCCAGTGG - Exonic
1087402685 11:97687338-97687360 GCACAAGCAATTGTCTTCAGAGG + Intergenic
1089413766 11:118269585-118269607 GCACACACTAATGTCTTGTTTGG - Intergenic
1090513946 11:127404624-127404646 GCACACACATATTTCTTTGTCGG + Intergenic
1092972672 12:13712586-13712608 GCTTTCACAAATGCCTTCATGGG - Intronic
1093761773 12:22918982-22919004 ACAAACACAAATGCCTACATGGG + Intergenic
1094163107 12:27412628-27412650 GGACACACACATGTGTACATTGG - Intronic
1096934252 12:55253803-55253825 GCAAAGACAACTTTCTTCATGGG + Intergenic
1097566740 12:61279824-61279846 GGCCACATAAATGTCTTCTTTGG - Intergenic
1098826457 12:75303799-75303821 GCACTCACACATGTCCTTATTGG + Intronic
1099562627 12:84197235-84197257 GGCCACATAAATGTCTTCTTTGG - Intergenic
1099717263 12:86311572-86311594 GCACACAGAGCTGGCTTCATGGG + Intronic
1102722662 12:115031182-115031204 GCACACACACATATGTACATAGG - Intergenic
1102930947 12:116861685-116861707 GCACGCACAAATGTCTATTTGGG - Intronic
1104593840 12:130105947-130105969 GCACACAGAAGTGTTTTTATTGG + Intergenic
1105429042 13:20320431-20320453 CCACACACAACTGGCTTCAGGGG - Intergenic
1107972523 13:45657448-45657470 GCACAAGCATATGGCTTCATTGG - Intergenic
1108051953 13:46453966-46453988 ACACACACACACGTCTTTATAGG + Intergenic
1109539338 13:63752223-63752245 ACACACACACACGTCTTTATAGG - Intergenic
1109544506 13:63827611-63827633 ACACACACACACGTCTTTATAGG + Intergenic
1110135970 13:72067592-72067614 GGTCACATAAATGTCTTCTTTGG - Intergenic
1110972816 13:81787778-81787800 GGACTCGCAAATGTCTTCTTTGG - Intergenic
1112058897 13:95717154-95717176 GCACGAACAAATGTCTTAAGTGG + Intronic
1114727960 14:24959132-24959154 GCAAAAACAAATCTCTTCAAGGG + Intronic
1115051984 14:29073661-29073683 GCAAACACATATTTCTTCACAGG + Intergenic
1115711190 14:36052886-36052908 ACACACACAATTTTCATCATTGG - Intergenic
1116190952 14:41665257-41665279 ACATACATAAATTTCTTCATTGG - Intronic
1116225058 14:42139828-42139850 GCATACACATTTGTTTTCATTGG + Intergenic
1119464389 14:74843426-74843448 GCACATTCAAATGCCTTCAAAGG + Intronic
1119610935 14:76061461-76061483 GCCCACACAATTGTCTCCACAGG + Intronic
1120068383 14:80073339-80073361 GCACACCCAGATGACTTCACTGG + Intergenic
1120320555 14:82955193-82955215 CCACACGCATATATCTTCATTGG + Intergenic
1122427243 14:101618824-101618846 CCAGACTCAGATGTCTTCATTGG + Intergenic
1123162740 14:106295294-106295316 GCTCACACTAATATCTTCAGAGG + Intergenic
1130151125 15:81312489-81312511 GCACGCACTCATGTCTGCATGGG - Exonic
1132219083 15:100091588-100091610 TCAGACACAAATGACTTCACAGG - Intronic
1132341603 15:101081738-101081760 GCACACACATATATATACATAGG + Intergenic
1133578652 16:7120645-7120667 TCAGACACAAATGGTTTCATTGG + Intronic
1134188477 16:12102548-12102570 GGCCACATAAATGTCTTCTTTGG + Intronic
1134423342 16:14114932-14114954 GCACACAGAAAGCTCTTCATAGG + Intronic
1136087367 16:27895122-27895144 GCCCACAGAAATGTCTTGTTTGG + Intronic
1137540988 16:49361496-49361518 ACAAACACAAATGTCTTCAAGGG + Intergenic
1138130320 16:54473799-54473821 GCAAACACAGATGCCTTCAAAGG + Intergenic
1138986837 16:62339348-62339370 GCAGACACAAATGGCTCCACAGG - Intergenic
1139155127 16:64432281-64432303 GGCCACATAAATGTCTTCTTTGG + Intergenic
1140645260 16:77023019-77023041 GCAAACACAAATGTCCCAATGGG - Intergenic
1140702310 16:77592307-77592329 GCAAACACAAATGTCTGCAAGGG + Intergenic
1140954762 16:79852327-79852349 GGCCACATAAATGTCTTCTTTGG + Intergenic
1143576595 17:7797428-7797450 GCAGACACAGAAGCCTTCATGGG + Exonic
1144684554 17:17217242-17217264 GAACACACAAATAACTTCATGGG - Intronic
1144768369 17:17745392-17745414 ACACACACAAAAGCCTTCAATGG - Intronic
1146598912 17:34195048-34195070 GCACACACATATATATGCATGGG + Intergenic
1147607547 17:41782737-41782759 CCACTCACACATGCCTTCATGGG + Intronic
1150012810 17:61521939-61521961 GCCCAGAAAAATGTCTTCATTGG - Intergenic
1157743498 18:50114573-50114595 GCTCAGACAAATGTCTGAATTGG - Intronic
1159805540 18:72953738-72953760 ACTCACACAAAAGTCTACATGGG + Intergenic
1162930980 19:13957509-13957531 GCACACACAGGGGCCTTCATTGG - Intronic
1167681609 19:50926354-50926376 ACGCACACAAATGTCAACATTGG + Intergenic
1168472982 19:56654797-56654819 GCACACACATATCTCTTGAGGGG + Intronic
925243115 2:2351333-2351355 GGGCACATAAATGTCTTCTTTGG + Intergenic
925426773 2:3755632-3755654 ACACACACATATGTAGTCATAGG - Intronic
926072996 2:9915767-9915789 GCTCACACAAAAATCTGCATAGG + Intronic
926478921 2:13363883-13363905 GGCCACATAAATGTCTTCTTTGG + Intergenic
927255537 2:21037525-21037547 GAACACACAAAAGTGCTCATGGG + Intronic
927372324 2:22370802-22370824 GCAAGTACAAGTGTCTTCATAGG + Intergenic
928057777 2:28075237-28075259 GGACACACAACTGTCTGGATTGG + Intronic
929030171 2:37642843-37642865 GCACACACAAAAGACTACACTGG - Exonic
929410794 2:41695966-41695988 GCACACACAAAGCCCATCATTGG + Intergenic
931091055 2:58886655-58886677 GCACAAACAAATGTATTCAGTGG + Intergenic
932564030 2:72894487-72894509 GGGCACACATATGTATTCATAGG - Intergenic
933272326 2:80246358-80246380 GCACATACAATTGTATTGATTGG + Intronic
933404196 2:81837368-81837390 GGCCACACGAATGTCTTCTTTGG + Intergenic
933585622 2:84176742-84176764 GAACAAGCAAATGTTTTCATGGG + Intergenic
933982539 2:87564302-87564324 ACACACACAAATATCATCTTTGG - Intergenic
935444892 2:103145951-103145973 GAAGACACAAATCTCTTCTTGGG - Intergenic
935501493 2:103845955-103845977 GAACACACAAATATTCTCATTGG - Intergenic
936311302 2:111386490-111386512 ACACACACAAATATCATCTTTGG + Intergenic
937782834 2:125858988-125859010 CCACACACTAATCTTTTCATAGG + Intergenic
938184173 2:129213547-129213569 GCACACACAATTGTCTTGAAGGG + Intergenic
938584794 2:132679588-132679610 GCACAGAGAAGTGTCTCCATGGG + Intronic
938635335 2:133219362-133219384 GCAAACACAAATGTCTTTTGGGG + Intronic
938651785 2:133390714-133390736 GCACACACACACTTCTACATAGG - Intronic
939626498 2:144484029-144484051 CCACACTCAAATGTCTACACAGG + Intronic
941038546 2:160594549-160594571 GCAGGCCCAGATGTCTTCATTGG - Intergenic
941428191 2:165376802-165376824 GCAGACACAATAGTCTTAATTGG - Intronic
942483465 2:176415011-176415033 TCACAAAGAAATGTCTGCATCGG + Intergenic
943107950 2:183570876-183570898 GCACATACAACTGTCTTTCTAGG + Intergenic
943762356 2:191623616-191623638 GAACTCACATGTGTCTTCATGGG - Intergenic
944324184 2:198384237-198384259 ACACACACAAATGTCCACAATGG - Intronic
944774296 2:202946841-202946863 GGCCACATAAATGTCTTCTTTGG - Intronic
944924568 2:204451277-204451299 GCAAACTCAAATGCCTTCAGGGG + Intergenic
945299504 2:208202791-208202813 ACAAACACAAAAATCTTCATGGG - Intergenic
948629765 2:239294599-239294621 GCACACACAGATGTATTTGTGGG + Intronic
1168879354 20:1193662-1193684 GCACTCACAAAAGTCTTGAGAGG + Intergenic
1170052416 20:12160450-12160472 GCACACAAAAATTTATTGATGGG + Intergenic
1173070681 20:39761837-39761859 ACACACAGAACTGTCTACATCGG - Intergenic
1173220392 20:41127697-41127719 GCCCACACAAATGTTTTTAAAGG + Intergenic
1174652779 20:52142410-52142432 ACACACACAAATTGCTTAATGGG + Intronic
1174870513 20:54176929-54176951 TCACACACACATGTTGTCATGGG - Intergenic
1177057391 21:16323924-16323946 GCACACAAAAATCTCTTTAAGGG - Intergenic
1177405166 21:20657604-20657626 ACACACACAAATATCTGCTTTGG - Intergenic
1177503412 21:21988604-21988626 ACACAAACAAATGTCAACATGGG + Intergenic
1177584539 21:23073286-23073308 GGCCACATAAATGTCTTCTTAGG - Intergenic
1178801081 21:35796325-35796347 GCAGCCAAAAATGTCTTGATGGG + Intronic
1179236404 21:39551037-39551059 GGCCACATAAATGTCTTCTTTGG + Intergenic
1179578899 21:42325835-42325857 GCAAACACAACTATCTTCAGAGG + Intergenic
1181406388 22:22687734-22687756 CCACTCAAAAATGTCTTCAGTGG - Intergenic
1181575599 22:23792504-23792526 CCACACCCAAATGTCTCCATGGG - Intronic
949743051 3:7258520-7258542 CCACAGACAAATGGTTTCATTGG + Intronic
950442025 3:13015821-13015843 GCAAACCCAAATGGCTTCACTGG + Intronic
952868369 3:37874032-37874054 GTAAACAGAAATGTCTTCTTGGG + Intronic
953531460 3:43743823-43743845 ACACACACACATTTCTACATAGG - Intergenic
953949362 3:47176643-47176665 GGACATACATATGTCTTCAAAGG - Intergenic
955129367 3:56149111-56149133 GGACACAAAAATCGCTTCATTGG - Exonic
957426119 3:80041383-80041405 CCCCACACACATGCCTTCATTGG - Intergenic
957546991 3:81651912-81651934 GTACACACAAATGTCTCCAGAGG + Intronic
957622482 3:82611880-82611902 GGCCACATAAATGTCTTCTTTGG + Intergenic
959084145 3:101833734-101833756 ACACACAGAACTGTTTTCATTGG - Intronic
960427454 3:117526589-117526611 GCAGAAACAAATGTTTTCTTTGG + Intergenic
960915985 3:122695219-122695241 ACACACACGAATGTCTTACTTGG - Intronic
961461505 3:127053026-127053048 GCAAACAAAAATGTCCTCCTGGG + Intergenic
961862570 3:129928355-129928377 GCAAACTCAAATGTCTTCAGGGG + Intergenic
961922254 3:130439622-130439644 GCACAGTCAATTCTCTTCATTGG - Intronic
962110304 3:132438668-132438690 GGTCACACAAATATCTTCAAGGG - Intronic
962930893 3:140034959-140034981 CCACACACAAATCTTTTCTTGGG + Intronic
963139069 3:141932852-141932874 GCACCCACAGGTGTATTCATAGG - Intergenic
964439585 3:156693257-156693279 GGAAACACAAATGTTTTTATTGG + Intronic
967239077 3:187418537-187418559 GACCACATAAATGTCTTCTTTGG - Intergenic
968404035 4:323984-324006 ACATACATAAATGTCTTAATAGG + Intergenic
970158594 4:13166709-13166731 GCACACTAAAATCTATTCATTGG + Intergenic
971331628 4:25686127-25686149 TAACAAACAAATGTCCTCATTGG - Intergenic
971723125 4:30272879-30272901 GGCCACATAAATGTCTTCTTTGG + Intergenic
972084142 4:35192508-35192530 ACACACACATTTGTCTTCATGGG - Intergenic
972486928 4:39550580-39550602 GCACTTAAAAATGTCTGCATGGG - Exonic
972500269 4:39671256-39671278 GGCCACATAAATGTCTTCTTTGG + Intergenic
973918174 4:55657559-55657581 GCACACTGAAATGTGTTCTTGGG - Intergenic
976504497 4:85831567-85831589 GAACACACCAATGTGTTCAGAGG + Intronic
978830662 4:113080353-113080375 TCACACACAAATCTCTTCCTTGG - Intronic
980903004 4:138922733-138922755 GAACACACATAGGACTTCATAGG + Intergenic
983202640 4:164878947-164878969 GCAAACACAATTGCCTTCAGAGG + Exonic
983851472 4:172585868-172585890 GGTCACATAAATGTCTTCTTTGG - Intronic
985338239 4:188919262-188919284 GTACACACAAATCTCTAGATGGG + Intergenic
986428543 5:7658386-7658408 ACACACACAATTCTCTTCACTGG - Intronic
993401021 5:87451153-87451175 GAACGCATAAATGTCTTGATTGG + Intergenic
994073209 5:95623555-95623577 GCACACAGACCTGTCTTCACTGG - Intergenic
995010982 5:107256992-107257014 GCAAACTCAAATGTCTACAAGGG - Intergenic
996980451 5:129486134-129486156 CCAGACCCAAATGACTTCATTGG + Intronic
998029504 5:138852871-138852893 GCACACACACATTTTTGCATAGG + Intronic
998861568 5:146448676-146448698 GCACACACAAATCTCCACTTTGG + Intronic
999083643 5:148867691-148867713 GCAAATACAAATGCCTTTATAGG + Intergenic
999131809 5:149289342-149289364 ACACACACAAAAGTCTTCCAAGG + Intronic
1000385647 5:160672419-160672441 GCACACCCCAAAGTCTTCATGGG - Intronic
1000439468 5:161249236-161249258 CCACACAGGAATGTCTGCATTGG + Intergenic
1000555569 5:162721528-162721550 CCAAACACAAATGCTTTCATGGG - Intergenic
1000663380 5:163963980-163964002 GTACATACAAATGTTTTCTTAGG + Intergenic
1000814504 5:165904260-165904282 ACACACACACATGTATTTATAGG - Intergenic
1002912538 6:1501356-1501378 GCACACACACATATTTTGATGGG - Intergenic
1004608878 6:17219757-17219779 ATTCACACAAATGTGTTCATAGG + Intergenic
1005180615 6:23101098-23101120 CCAGCCACAAATGGCTTCATGGG - Intergenic
1008778527 6:55072016-55072038 GCACACATACATATCTTCCTAGG + Intergenic
1009275712 6:61676588-61676610 GCACACACAATTGCTTTCACAGG - Intergenic
1011193430 6:84758810-84758832 GTACAAACAAATTTCTTCTTGGG + Intronic
1011538428 6:88403662-88403684 GCACACAGAATTGGCTTCCTGGG - Intergenic
1012768251 6:103396921-103396943 GGAGAGACAAATGTTTTCATCGG + Intergenic
1013706706 6:112843779-112843801 GGCCACATAAATGTCTTCTTTGG + Intergenic
1016567118 6:145468063-145468085 GGACAGACACATGTATTCATTGG - Intergenic
1019792018 7:3020996-3021018 GGCCACATAAATGTCTTCTTTGG - Intronic
1020695553 7:11409637-11409659 GCACACATAAATGTACTCCTTGG - Intronic
1021148104 7:17114415-17114437 GGCCACATAAATGTCTTCTTTGG + Intergenic
1021551964 7:21880219-21880241 GATGACACAAATGGCTTCATGGG + Intronic
1023063291 7:36350491-36350513 GCCCACAGAGAGGTCTTCATTGG + Intronic
1024473505 7:49787662-49787684 ACACACACAAATGTCATGAGTGG + Intronic
1024654980 7:51444520-51444542 TCAGGCACAAATGGCTTCATTGG - Intergenic
1026460625 7:70612028-70612050 GTATACACAAATGTGTGCATTGG + Intronic
1026789956 7:73325003-73325025 ACACACACACATATCTTCAAGGG - Intronic
1029503972 7:100950942-100950964 TCACACACTAATGACTTCAAAGG - Intronic
1029651625 7:101897018-101897040 GCACACACAACTGTCTTGAAGGG + Intronic
1030160001 7:106497695-106497717 GGCCACATAAATGTCTTCTTTGG - Intergenic
1030905539 7:115176837-115176859 GCAAACAAAAATGATTTCATGGG + Intergenic
1031172921 7:118314069-118314091 GGCCACATAAATGTCTTCTTTGG + Intergenic
1033566027 7:142579010-142579032 ACCCACAGAAATGTTTTCATAGG + Intergenic
1035079036 7:156200895-156200917 GCACAGATAAATGTCACCATGGG - Intergenic
1035623657 8:1054337-1054359 GGACACAAAAATGTTTTAATGGG - Intergenic
1036864252 8:12380659-12380681 ACACACACACACGGCTTCATAGG - Intergenic
1038448714 8:27624330-27624352 GTACACAGAAATGTCCTTATGGG - Intergenic
1040484441 8:47856640-47856662 ACACACACACATGTCTACACTGG + Intronic
1040719133 8:50295953-50295975 ACACACTCAAATGCCATCATAGG - Intronic
1040809413 8:51435016-51435038 ACACACACAAGAGTCTTCATTGG + Intronic
1041342281 8:56858404-56858426 GCAGAAACAAATTGCTTCATAGG - Intergenic
1041401084 8:57446064-57446086 GCACACAAAAATGTGTTCTGTGG - Intergenic
1043317674 8:78941597-78941619 GCCCACACCAATGGCCTCATTGG - Intergenic
1045352484 8:101354946-101354968 GGACACAGAAAAGACTTCATTGG + Intergenic
1046726557 8:117681174-117681196 CCACACCAAAATGTCATCATTGG + Intergenic
1047813110 8:128431951-128431973 CCATACACAAATGTATTCTTAGG - Intergenic
1049587617 8:143439273-143439295 GCACACTCAAATGCCTGCCTCGG - Intronic
1050612747 9:7370281-7370303 GCTCCCAGAAAGGTCTTCATTGG - Intergenic
1052214002 9:25943111-25943133 GCAGACACATATGTCTTCGTTGG + Intergenic
1052273566 9:26653127-26653149 ACACACACAAATGTAATCATTGG + Intergenic
1053524972 9:38819283-38819305 ACAGACACAAATGTGTACATGGG - Intergenic
1054197203 9:62043698-62043720 ACAGACACAAATGTGTACATGGG - Intergenic
1054641205 9:67544996-67545018 ACAGACACAAATGTGTACATGGG + Intergenic
1055148194 9:72961723-72961745 GGCCACATAAATGTCTTCTTTGG - Intronic
1056275467 9:84990642-84990664 ACACACACAAATGTTCTCTTTGG - Intronic
1056880078 9:90382977-90382999 TCTCACAGAAATGTCCTCATTGG + Intergenic
1058163628 9:101595862-101595884 ACACACACAAAAGGCTTCTTTGG - Intronic
1060428201 9:123524410-123524432 GCAAACGCAAAAGCCTTCATGGG + Intronic
1188837416 X:34976163-34976185 GCACAAACAAAAGTCTTCTTTGG + Intergenic
1188991020 X:36820492-36820514 GCACAAAGAAAGGTCTTCTTTGG - Intergenic
1190059675 X:47202764-47202786 GCACCCATAAACGCCTTCATTGG + Exonic
1192559826 X:72120301-72120323 CCAGACATAAATGACTTCATTGG - Intergenic
1193942537 X:87693560-87693582 GCAAATTCAAATGTTTTCATAGG + Intergenic
1194052869 X:89093700-89093722 ACACACACCTATGGCTTCATGGG + Intergenic
1194643051 X:96426379-96426401 GGCCACATAAATGTCTTCTTTGG + Intergenic
1196060441 X:111402735-111402757 ACACACATAAATGTCCTCAAAGG - Intronic
1197176399 X:123490514-123490536 CTACACACAAATGTTTTCATAGG + Exonic
1197331321 X:125156421-125156443 GCAGACACCAATGTCTACTTTGG - Intergenic
1198042819 X:132871133-132871155 GGCCACATAAATGTCTTCTTTGG - Intronic
1199240335 X:145540987-145541009 GCTCACACCGATGTCCTCATGGG + Intergenic
1200141685 X:153905720-153905742 GCACCCATACACGTCTTCATTGG + Exonic
1202115287 Y:21465781-21465803 GCACACCCAGATGTCGGCATGGG - Intergenic