ID: 1072946178

View in Genome Browser
Species Human (GRCh38)
Location 10:99811859-99811881
Sequence TTGTGTGTGCAGATTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072946174_1072946178 1 Left 1072946174 10:99811835-99811857 CCAGCTGTGATCCCATGAAGACA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG No data
1072946172_1072946178 23 Left 1072946172 10:99811813-99811835 CCTACTATGGGGCCATGAATATC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG No data
1072946173_1072946178 11 Left 1072946173 10:99811825-99811847 CCATGAATATCCAGCTGTGATCC 0: 1
1: 0
2: 3
3: 110
4: 320
Right 1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG No data
1072946175_1072946178 -10 Left 1072946175 10:99811846-99811868 CCCATGAAGACATTTGTGTGTGC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072946178 Original CRISPR TTGTGTGTGCAGATTGTGGA TGG Intronic
No off target data available for this crispr