ID: 1072950952

View in Genome Browser
Species Human (GRCh38)
Location 10:99846332-99846354
Sequence AAACTACCCCCAGAGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072950952 Original CRISPR AAACTACCCCCAGAGGAACT GGG (reversed) Intronic
901873144 1:12150269-12150291 AAATTCCAGCCAGAGGAACTTGG - Intergenic
903732182 1:25504806-25504828 AACCAACCCAAAGAGGAACTTGG + Intergenic
904184003 1:28688592-28688614 AAACTACATCCAAAGTAACTAGG - Intronic
905179028 1:36155551-36155573 TAATTACCCCCAGAGGAGCAGGG + Intronic
911170224 1:94763653-94763675 AAACTACCGTCAGAGTAAATAGG + Intergenic
911230281 1:95353899-95353921 AAAATACCCCCAGAGATTCTGGG + Intergenic
911700880 1:100950576-100950598 AAAATAACCCCAGTGGACCTTGG - Intronic
912732077 1:112116023-112116045 AACCTACTCACAGAGGAACCTGG - Intergenic
914677352 1:149915384-149915406 TAACTACCTCCAGAAGAACAAGG + Intronic
917987787 1:180338719-180338741 AAACTACCACCAGAGTGAATAGG + Intronic
919388295 1:196949525-196949547 AAACTTCCCCTGTAGGAACTTGG - Exonic
919390800 1:196982955-196982977 AAACTTCCCCTGTAGGAACTTGG - Exonic
919944694 1:202310540-202310562 AGACTACACCCAGAGGTGCTTGG + Intronic
923433011 1:233941928-233941950 AAACAACCCCAAGAGGCACAAGG - Intronic
923983718 1:239355506-239355528 ATTCTAGCCCCAAAGGAACTTGG + Intergenic
1064216676 10:13406338-13406360 AATCTACCCCCATGGGCACTGGG + Intergenic
1065683695 10:28263186-28263208 ACACTACCACCAGAGAAATTTGG - Intronic
1067495678 10:46758002-46758024 TTACTACCCCCTGAGAAACTAGG - Intergenic
1067598974 10:47582386-47582408 TTACTACCCCCTGAGAAACTAGG + Intergenic
1067948637 10:50708971-50708993 TTACTACCCCCTGAGAAACTAGG + Intergenic
1068453142 10:57219519-57219541 AAACTACCTGCAGAGAAACAGGG - Intergenic
1069263831 10:66433595-66433617 AAACTACCATCAGAGGAAACAGG - Intronic
1070029808 10:72666115-72666137 ATAATACCTCCAGTGGAACTGGG - Intergenic
1072631619 10:97150661-97150683 AAAGGAAGCCCAGAGGAACTGGG + Intronic
1072950952 10:99846332-99846354 AAACTACCCCCAGAGGAACTGGG - Intronic
1074867981 10:117555898-117555920 AAAGTACCCCCACAGGCCCTGGG - Intergenic
1074898278 10:117795500-117795522 GAACCACCCCCAGAGAGACTTGG - Intergenic
1075707277 10:124508985-124509007 AAACTACCCCAACAGGTACTAGG - Intronic
1081272411 11:41101192-41101214 AAACTACCAACAGAGTAAATAGG + Intronic
1081741649 11:45445117-45445139 AAGCTACCCTCTGAGGAACATGG + Intergenic
1085672766 11:78484428-78484450 AAACTACCACCAGAGTAAAGAGG + Intronic
1086420878 11:86635956-86635978 AAAGCAGCCCCAGAAGAACTAGG - Intronic
1092999831 12:13983744-13983766 AAAATATCCCCAGAGGAGGTGGG - Intergenic
1095044536 12:37486560-37486582 ACACTCCCCCCAGAGGAATAGGG + Intergenic
1095188403 12:39228294-39228316 AAACCACCCCCTGAGAAACAAGG - Intergenic
1099932098 12:89086616-89086638 AAACTTCCCCCGAAGGAACAAGG + Intergenic
1101022620 12:100568775-100568797 AAACTCCCCCCAAAGGCTCTAGG + Intergenic
1102677154 12:114666567-114666589 TAATTTCCCCCAGAGGATCTTGG + Intergenic
1107155316 13:37159657-37159679 AAATTACACCTAGAGGAACTAGG - Intergenic
1107779533 13:43883315-43883337 AATCTACTCCAGGAGGAACTAGG + Intronic
1110747428 13:79070663-79070685 AAACAACTCCCAGATGAACCAGG + Intergenic
1111000229 13:82169183-82169205 AAACTAAACCCACAGGAAGTAGG + Intergenic
1111598741 13:90444838-90444860 AAACTACCCTCACAGGAATATGG + Intergenic
1113228122 13:108180997-108181019 AATCTGCCCCCAGAGAACCTGGG - Intergenic
1113787263 13:113009021-113009043 AGACGACCCCCAGAGGAGATTGG + Intronic
1114753974 14:25237686-25237708 AAACTGCTCCCAGAGAAACCAGG - Intergenic
1121327239 14:93028340-93028362 AACCAACCCCCAGAGGTACAGGG + Intronic
1121721212 14:96109911-96109933 CTACTTCCCCCACAGGAACTTGG + Intergenic
1122942496 14:104988111-104988133 AAACTGCCCCCAGCTGAGCTGGG + Intronic
1125484142 15:40100727-40100749 AAACGACACCCAGGGAAACTTGG + Intronic
1128308431 15:66615269-66615291 AAGCCTCCCCTAGAGGAACTGGG - Intronic
1132021988 15:98370819-98370841 AAGCTATACCCAGAGGAACACGG - Intergenic
1133363559 16:5193172-5193194 AAACCACCCTCAGAGCAAGTTGG - Intergenic
1137897051 16:52225122-52225144 AAACTATCCACAGAGTAAATAGG - Intergenic
1141280341 16:82625357-82625379 AAACAACCCCCAGATGAAACTGG - Intergenic
1141656643 16:85420279-85420301 ACACTCCCTCCAGAGGTACTAGG - Intergenic
1143507024 17:7372540-7372562 AATCAACCTCCTGAGGAACTGGG - Intergenic
1146205771 17:30904566-30904588 CAACTAACCCCAAAGGAAGTAGG - Intronic
1149125912 17:53232659-53232681 ACACTCCCTCCAGAGGCACTGGG + Intergenic
1155086701 18:22466007-22466029 AAACTACCCCCAGAGAAGCTGGG - Intergenic
1157418278 18:47524214-47524236 AAACTAGCACTAGATGAACTTGG - Intergenic
1160173444 18:76573139-76573161 AACACACCCCCATAGGAACTAGG - Intergenic
1167885333 19:52495280-52495302 ATACTACCCCCTGAGTAGCTGGG + Intronic
1167890899 19:52538458-52538480 ATACTACCCCCTGAGTATCTGGG + Intronic
1167913476 19:52721930-52721952 ATACTACCCCCTGAGTAGCTGGG - Intronic
925832816 2:7912741-7912763 AAGCTAAGCCCAGAGGAAATGGG + Intergenic
930954197 2:57184965-57184987 ACATCACACCCAGAGGAACTAGG + Intergenic
931501896 2:62877904-62877926 ATACCACACCTAGAGGAACTAGG + Intronic
932064381 2:68537950-68537972 AAACTTCCAATAGAGGAACTTGG + Exonic
933152974 2:78937118-78937140 AAACTACAATCAGAGGAAATGGG - Intergenic
939013882 2:136878868-136878890 AAACTACCACCAGAGCAAACAGG - Intronic
940438579 2:153685616-153685638 AAACTATCCACAGAGTAACCAGG - Intergenic
941744593 2:169073536-169073558 AGGGTACCCCCAGAGGAGCTGGG + Intronic
942863867 2:180648761-180648783 AAGCTACACCCAGAGAAACAAGG - Intergenic
943640715 2:190354705-190354727 AAACTAACACCAGAAGAATTAGG + Intronic
947654171 2:231812055-231812077 AAACAACCCCAAGAAGAGCTGGG - Intergenic
947937328 2:234019296-234019318 AAACATCCACCAGATGAACTGGG - Exonic
1168906204 20:1405706-1405728 TAACTACACCCAGAAGAATTGGG - Intergenic
1171842023 20:30225500-30225522 ACACTCCCCCCAGAGGAATAGGG + Intergenic
1172392496 20:34575362-34575384 AGAGCACCCCCAGAGGTACTGGG + Intronic
1175872510 20:62215155-62215177 CAACAACCCCCAGAGGTCCTGGG + Exonic
1177659634 21:24065831-24065853 GAACTTCCCCTAGAGCAACTTGG + Intergenic
1179969769 21:44828805-44828827 ACATTACACCCAGAGGAACAAGG + Intergenic
952189943 3:31012202-31012224 AAACTACACACAGATGAAATAGG - Intergenic
955060098 3:55486502-55486524 AGAGAACCCGCAGAGGAACTAGG - Intronic
960441995 3:117700248-117700270 ATACCTCCCCCAGAGGAAATGGG + Intergenic
966242106 3:177766133-177766155 AAGGTACCCCTAGAGCAACTAGG - Intergenic
972948684 4:44290884-44290906 ATACTACACCTAGAGGAACCAGG + Intronic
975536590 4:75457961-75457983 AAACTAAGACCAGAGGACCTAGG + Intergenic
977267855 4:94877368-94877390 AAATTAACCCCAGAGGAAAGGGG + Intronic
980566494 4:134549670-134549692 AAAGTACCCCCAGCAGAACCAGG - Intergenic
982036066 4:151347173-151347195 AACCTACCACCAGAGCAACTGGG - Intergenic
982323390 4:154104111-154104133 AAACTACCATCAGAGTAAATAGG - Intergenic
982752998 4:159184694-159184716 AAACTACCATCAGAGTAAATAGG - Intronic
987697137 5:21346495-21346517 ACACTACACCTAAAGGAACTAGG - Intergenic
988412847 5:30909434-30909456 AAACTACCCCCAAAAAAATTAGG + Intergenic
988755099 5:34240201-34240223 ACACTACACCTAAAGGAACTAGG + Intergenic
989078553 5:37590755-37590777 ACACTTCCTCTAGAGGAACTGGG - Intronic
991532196 5:67627908-67627930 AAACTACCACCAGAGGGAATAGG - Intergenic
991743320 5:69705882-69705904 ACACTACACCTAAAGGAACTAGG + Intergenic
991754379 5:69849321-69849343 ACACTACACCTAAAGGAACTAGG - Intergenic
991794893 5:70285618-70285640 ACACTACACCTAAAGGAACTAGG + Intergenic
991803998 5:70406072-70406094 ACACTACACCTAAAGGAACTAGG - Intergenic
991822704 5:70581193-70581215 ACACTACACCTAAAGGAACTAGG + Intergenic
991833704 5:70724469-70724491 ACACTACACCTAAAGGAACTAGG - Intergenic
991887267 5:71285156-71285178 ACACTACACCTAAAGGAACTAGG + Intergenic
994344975 5:98673794-98673816 AAACTACCCTCAGAGTGAATAGG + Intergenic
995568458 5:113455659-113455681 ACAATAGCCCCAGAGGAATTTGG + Intronic
998150832 5:139756525-139756547 AAACTACCCCCAAGGGACCCTGG - Intergenic
998369221 5:141650528-141650550 TAACTACACCCAGAGGGAATGGG + Intronic
998892224 5:146758274-146758296 GAACTAGCACCAGAGGAGCTAGG + Intronic
1000083823 5:157871675-157871697 AAACCTTCCCAAGAGGAACTAGG - Intergenic
1001073082 5:168603865-168603887 CAACAAAACCCAGAGGAACTGGG - Intergenic
1002422385 5:179155375-179155397 AAACGCCCCCCAGAGGAGGTGGG - Intronic
1005553722 6:26951907-26951929 ACACTACGCCTAAAGGAACTAGG + Intergenic
1010789528 6:80049037-80049059 AAACTACCATCAGAGTAAATGGG - Intergenic
1013881733 6:114911488-114911510 AAACTGACTTCAGAGGAACTAGG + Intergenic
1021839099 7:24707810-24707832 ACACTTCCCCCAGAGGATCTAGG - Intronic
1023546127 7:41319205-41319227 AAGCTCCCACCAGAGGATCTAGG - Intergenic
1025290463 7:57716102-57716124 ACACTCCCCCCAGAGGAATAGGG + Intergenic
1029599911 7:101557605-101557627 AAGATGCCCCCAGGGGAACTGGG + Exonic
1030475699 7:110031081-110031103 AAACTACCACCAGAGTGAATGGG - Intergenic
1031384655 7:121133649-121133671 AATCTACCCTCAAAGGAAGTAGG - Intronic
1032336355 7:131028501-131028523 AAACTAAGCTGAGAGGAACTTGG - Intergenic
1034852577 7:154508686-154508708 CAACTAACCTCAGAGGAATTTGG + Intronic
1036105187 8:5830485-5830507 AAACCACCCCCAGAGGAGAATGG + Intergenic
1037398799 8:18472097-18472119 AAACTACCACCAGAGCAAACAGG + Intergenic
1037931146 8:22881020-22881042 AAACTAAATCCAGAGGATCTGGG - Intronic
1038103815 8:24411093-24411115 AAACTATCAACAGAGTAACTAGG - Intergenic
1039322971 8:36453074-36453096 TAACTATCCCCAGAGCCACTGGG + Intergenic
1041746268 8:61211989-61212011 ATACTCCCCCCAGAGGATCGAGG - Intronic
1042959768 8:74291170-74291192 AAACTACCATCAGAGTGACTAGG + Intronic
1045665545 8:104480549-104480571 AAAGTACCACCAAAGGAAATAGG + Intergenic
1048122312 8:131595659-131595681 AAACTACCATCAGAGTAAATGGG - Intergenic
1051653743 9:19356985-19357007 AAACTGTCACCAGAGGTACTTGG - Exonic
1053103312 9:35389852-35389874 GAGCTACCTCCAGAGGAACAAGG + Exonic
1053193316 9:36093165-36093187 AAACTGCCTCCAGAGGAAGGAGG + Intronic
1055439124 9:76321548-76321570 AAACTGCCCCGAGAGGCACGTGG + Exonic
1057454980 9:95199682-95199704 AAACTACCACCAGAGGCTCCTGG + Intronic
1058602494 9:106685007-106685029 AAACCAGCCCCAGGTGAACTGGG - Intergenic
1060249610 9:121975108-121975130 CAAGTACCCCCAGAGGAAGAGGG - Intronic
1188354753 X:29177034-29177056 AGGCTGGCCCCAGAGGAACTGGG + Intronic
1188653566 X:32662639-32662661 AAACTACTCCCAGAATAATTGGG - Intronic
1188848664 X:35104919-35104941 ATATTACACCCAGAGGAACTAGG + Intergenic
1194356632 X:92893372-92893394 ATATTACACCTAGAGGAACTAGG - Intergenic
1195758801 X:108224674-108224696 AAACAACCCGCAGAAGAAATGGG - Intronic
1196120508 X:112045382-112045404 ACACTACCTCCAGAGGCTCTAGG - Intronic
1196685767 X:118509146-118509168 AACTTACTCCTAGAGGAACTGGG - Intronic
1198400709 X:136265582-136265604 AAACAATCCCCAAAGGAACAAGG - Intergenic
1200041661 X:153375313-153375335 ACACTCCCCCCAGAGGCTCTAGG - Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1200664964 Y:6010373-6010395 ATATTACACCTAGAGGAACTAGG - Intergenic
1201783760 Y:17750961-17750983 AAACTACCATCAGAGTAAATGGG + Intergenic
1201817793 Y:18155026-18155048 AAACTACCATCAGAGTAAATGGG - Intergenic
1201915522 Y:19177683-19177705 AAACTACCATCAGAGTAAATAGG + Intergenic
1201984596 Y:19952077-19952099 AAACTACCACCAGAGGGAAGAGG + Intergenic