ID: 1072953667

View in Genome Browser
Species Human (GRCh38)
Location 10:99870291-99870313
Sequence CTGTGGGTACAACCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072953667_1072953674 2 Left 1072953667 10:99870291-99870313 CCCTCCATGGGTTGTACCCACAG No data
Right 1072953674 10:99870316-99870338 TAACCCCCGTGAGATGAACTGGG No data
1072953667_1072953673 1 Left 1072953667 10:99870291-99870313 CCCTCCATGGGTTGTACCCACAG No data
Right 1072953673 10:99870315-99870337 CTAACCCCCGTGAGATGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072953667 Original CRISPR CTGTGGGTACAACCCATGGA GGG (reversed) Intergenic
No off target data available for this crispr