ID: 1072954527

View in Genome Browser
Species Human (GRCh38)
Location 10:99877031-99877053
Sequence ATGGTTAAGCAACGCAGACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072954519_1072954527 20 Left 1072954519 10:99876988-99877010 CCCAATCGAGGAGAACAAGATCT 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1072954527 10:99877031-99877053 ATGGTTAAGCAACGCAGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 91
1072954520_1072954527 19 Left 1072954520 10:99876989-99877011 CCAATCGAGGAGAACAAGATCTG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1072954527 10:99877031-99877053 ATGGTTAAGCAACGCAGACAGGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072954527 Original CRISPR ATGGTTAAGCAACGCAGACA GGG Exonic
904086900 1:27915706-27915728 ATGGTTAAGTAAGATAGACATGG + Intergenic
909519294 1:76548391-76548413 ATGGCTCAGCAATGCAGTCAAGG + Intronic
910544832 1:88403014-88403036 ATTGTTCAGCATGGCAGACAAGG - Intergenic
911869867 1:103083198-103083220 ATGGTTAAGCAACACAGAAGGGG + Intronic
913217734 1:116634664-116634686 ATGGGTAAGCAGAGCAGGCACGG - Intronic
918308502 1:183268355-183268377 AGGGTTGAGCAAGGCAGATATGG + Intronic
921185942 1:212669663-212669685 TTTGTTAAGCAAAGCAGAAATGG + Intergenic
923324213 1:232866499-232866521 ATGGTTAAACAAGGCTGACCAGG - Intergenic
1064639138 10:17397652-17397674 ATGGTTAACAAATGCAGGCAGGG - Intronic
1072889987 10:99315489-99315511 ATGGTGAAGCGAAGCAGTCAGGG + Intergenic
1072954527 10:99877031-99877053 ATGGTTAAGCAACGCAGACAGGG + Exonic
1078567146 11:12426049-12426071 AGGGTCAAGCAAAGCAAACATGG + Intronic
1080930912 11:36809484-36809506 ATGGTTGACCAAAGGAGACAGGG + Intergenic
1081630325 11:44685144-44685166 AGTGTTAAGTAAGGCAGACAGGG + Intergenic
1083315549 11:61812896-61812918 GAGGTTAAGCAACACAGCCAAGG - Intronic
1090917095 11:131174988-131175010 ATGTTTGAGAAACGCAGAGAAGG - Intergenic
1090932978 11:131315431-131315453 ATGGTTAAGCAACGAAATGAAGG + Intergenic
1093409676 12:18849509-18849531 AATGTTAAACAAAGCAGACATGG + Intergenic
1094739540 12:33273172-33273194 TTGGCTGAGCAATGCAGACAAGG - Intergenic
1098942014 12:76548812-76548834 ATGGTTAAGAAAGACAGACTAGG - Intronic
1101450670 12:104775646-104775668 ATGGTTTCACAACACAGACATGG - Intergenic
1106050797 13:26187608-26187630 ATGGTTAAGTAACGTACCCAAGG + Intronic
1106827178 13:33536178-33536200 ATGGTGAAGCAAAACAGAAATGG + Intergenic
1109368881 13:61395791-61395813 ATGGTTTAGCAGTGCAGATAAGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110148790 13:72225232-72225254 ATGGTTAACCAACAGAGGCAAGG - Intergenic
1116802946 14:49462641-49462663 ATGGAAAAGCCACGCAGCCAGGG + Intergenic
1125748026 15:42010495-42010517 ATGGTTAGGCAACGGTGACCTGG + Intronic
1127270700 15:57398870-57398892 ATGGTTAAACAACAAAAACATGG - Intronic
1131797712 15:96036688-96036710 ATGCTTCAGCAACGAAGAAAGGG - Intergenic
1136586673 16:31190839-31190861 ATGGGTAAGAAAGGCAGACCTGG + Exonic
1140806487 16:78536809-78536831 ATGATGAAGCTACACAGACATGG - Intronic
1150017509 17:61573138-61573160 ATAGTTAAGCAACTAAGAAACGG - Intergenic
1153521867 18:5961494-5961516 AGGGTTGAGTAAAGCAGACATGG - Intronic
1157746126 18:50137417-50137439 ATGGTGAAGGAACCTAGACAAGG + Intronic
1162616531 19:11805505-11805527 ATGTTTAAACAATTCAGACAGGG + Intronic
1164447847 19:28332954-28332976 AAGGTAAAGGAATGCAGACATGG - Intergenic
924996541 2:366713-366735 AAGGAAAAGCAGCGCAGACAAGG - Intergenic
927131271 2:20062492-20062514 ATGGATGGGCAACCCAGACATGG + Intergenic
928629596 2:33177347-33177369 ATAGTTAAAAAATGCAGACAAGG + Intronic
929409459 2:41680900-41680922 ATGGGTAAGCAACTCACAGAAGG - Intergenic
937717649 2:125052778-125052800 ATGGGTCAGCAATGCAGATAAGG + Intergenic
939627285 2:144493423-144493445 GTGGTTAAGAAACGCACCCAGGG + Intronic
940908891 2:159192975-159192997 ATGGTTAAGAAACACATAAAAGG + Intronic
942325634 2:174774680-174774702 ATGGTTGAGGAAAGCAGAAACGG - Intergenic
945056994 2:205877998-205878020 ATGGTAAAGCAAGGCAGCAAGGG + Intergenic
948406178 2:237721377-237721399 ATGGTTAATCAACACAAATATGG + Intronic
948502168 2:238403563-238403585 AAGGAGAAGCAAGGCAGACAGGG - Intergenic
1170809626 20:19663640-19663662 ATGGTTCAGGGAGGCAGACAGGG - Intronic
1172830416 20:37829369-37829391 ATGGTTAAGAAAGACACACATGG - Intronic
1173195914 20:40912743-40912765 AAGGGTAAGCAAAACAGACATGG + Intergenic
1175603345 20:60292731-60292753 AGGGTCAAGAAACTCAGACAAGG - Intergenic
1177930211 21:27272322-27272344 ATTGTTAAGCCAAGCAGACAAGG + Intergenic
1180819044 22:18812734-18812756 ATGGGTAAGCAGAGCAGGCATGG - Intergenic
1181205268 22:21247182-21247204 ATGGGTAAGCAGAGCAGGCATGG - Intergenic
1182906502 22:33942027-33942049 CTGGTTAAGCAGAGCAGAAAAGG - Intergenic
1203221657 22_KI270731v1_random:48233-48255 ATGGGTAAGCAGAGCAGGCATGG + Intergenic
1203269169 22_KI270734v1_random:38587-38609 ATGGGTAAGCAGAGCAGGCATGG - Intergenic
950906869 3:16546411-16546433 ATGCTTCAGCCACGCAGAGACGG + Intergenic
953852581 3:46477468-46477490 GTGGTTAAACATCGCAGGCAGGG + Intronic
955002936 3:54943983-54944005 ATGGTTAGGAAACGAAGGCATGG - Intronic
958158269 3:89783924-89783946 ATAGTTAAGCAACACTGAAATGG - Intergenic
959051735 3:101530797-101530819 ATAGATAAGCAACTCTGACACGG - Intergenic
959786376 3:110303484-110303506 AAGGCTAAGCAACACAGCCAAGG - Intergenic
964413724 3:156426106-156426128 ATGGCTTAGCAAGGCAAACAAGG - Intronic
967225234 3:187284749-187284771 AAGGTTAAGCAACTCACCCAAGG - Intronic
972796223 4:42422611-42422633 AGGATTAAGCAACGTAGCCAAGG + Intronic
974101142 4:57418561-57418583 ATAGATAAGAAAAGCAGACAAGG + Intergenic
975358739 4:73441230-73441252 ATGGTCAAGATACACAGACATGG + Intronic
984157571 4:176210476-176210498 ATGGATATGCAACCCAGACTGGG + Intergenic
988245206 5:28671155-28671177 ATCTTAAAGCAAAGCAGACATGG - Intergenic
990158461 5:52907099-52907121 AAGGCTAAGCAACGCTGACAGGG - Intronic
998573096 5:143282933-143282955 ATGATTATGCCACTCAGACATGG - Intronic
998665901 5:144297394-144297416 TTGGTTAAGCAATGCAATCAAGG + Intronic
999169105 5:149578196-149578218 CTGGTTAACCAAAGCAGAAAAGG - Intronic
999499768 5:152135185-152135207 ACAGTTAAGCAAGGGAGACATGG + Intergenic
1004565725 6:16795259-16795281 ATGCTAAAGCAATGCTGACAGGG + Intergenic
1005056248 6:21731482-21731504 ATGGTTAAGCATCACTGAAAAGG - Intergenic
1005198571 6:23317207-23317229 ATGTTTCAGCAAGGCACACATGG + Intergenic
1010802333 6:80191075-80191097 ATGGTTAAACAATGCAAACCAGG - Intronic
1012853931 6:104478774-104478796 ATGGTTAAGTAACCCAGGCAAGG + Intergenic
1027444795 7:78261066-78261088 GTGTTTAAGGAAGGCAGACAGGG - Intronic
1028034120 7:85958287-85958309 ATGGTTAATAAACACAGAAAGGG - Intergenic
1029866339 7:103634664-103634686 ATAGTTAAGCAATGAATACAAGG - Intronic
1030815734 7:114034850-114034872 ATGTGCAAGCAAGGCAGACATGG - Intronic
1031883586 7:127222791-127222813 AAGGTTAAGCAACAAATACATGG + Intronic
1033735991 7:144222422-144222444 AGGGTTGAGCCACGCAGGCATGG + Intergenic
1033747060 7:144328530-144328552 AGGGTTGAGCCACGCAGGCATGG - Intergenic
1036471474 8:9056427-9056449 ATGGTTAAGCAAACTATACACGG - Intronic
1044763059 8:95542744-95542766 TTGTCTAAGCAATGCAGACATGG + Intergenic
1044893440 8:96862205-96862227 AAGGTTAAGCAACCTAGGCATGG - Intronic
1047356591 8:124127974-124127996 GAGGTGAAGCAACTCAGACAAGG - Intergenic
1048759913 8:137782601-137782623 ATGGTTAGGCAAAGCAGCAACGG + Intergenic
1052009349 9:23387422-23387444 ATGGATCAGGAACTCAGACACGG - Intergenic
1197489391 X:127099498-127099520 ATTGTGAAGAAACACAGACATGG + Intergenic
1199506428 X:148567049-148567071 AAGGTTAAGCACCGCAGGTAAGG - Intronic