ID: 1072962151

View in Genome Browser
Species Human (GRCh38)
Location 10:99939039-99939061
Sequence ATGGAGAAGTAGGATTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072962148_1072962151 -5 Left 1072962148 10:99939021-99939043 CCTATTCTAGAAGTGAGGATGGA 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG No data
1072962144_1072962151 15 Left 1072962144 10:99939001-99939023 CCAGAGTGGATAGACTGCCACCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG No data
1072962146_1072962151 -2 Left 1072962146 10:99939018-99939040 CCACCTATTCTAGAAGTGAGGAT 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG No data
1072962143_1072962151 16 Left 1072962143 10:99939000-99939022 CCCAGAGTGGATAGACTGCCACC 0: 1
1: 0
2: 3
3: 29
4: 119
Right 1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072962151 Original CRISPR ATGGAGAAGTAGGATTTGGA AGG Intronic
No off target data available for this crispr