ID: 1072965931 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:99972624-99972646 |
| Sequence | AAAGCGAGACCTGTTTCCCC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072965931_1072965933 | -9 | Left | 1072965931 | 10:99972624-99972646 | CCGGGGGAAACAGGTCTCGCTTT | No data | ||
| Right | 1072965933 | 10:99972638-99972660 | TCTCGCTTTATCACCCAGGCTGG | No data | ||||
| 1072965931_1072965934 | 1 | Left | 1072965931 | 10:99972624-99972646 | CCGGGGGAAACAGGTCTCGCTTT | No data | ||
| Right | 1072965934 | 10:99972648-99972670 | TCACCCAGGCTGGAGTGCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072965931 | Original CRISPR | AAAGCGAGACCTGTTTCCCC CGG (reversed) | Intronic | ||