ID: 1072965931

View in Genome Browser
Species Human (GRCh38)
Location 10:99972624-99972646
Sequence AAAGCGAGACCTGTTTCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072965931_1072965933 -9 Left 1072965931 10:99972624-99972646 CCGGGGGAAACAGGTCTCGCTTT No data
Right 1072965933 10:99972638-99972660 TCTCGCTTTATCACCCAGGCTGG No data
1072965931_1072965934 1 Left 1072965931 10:99972624-99972646 CCGGGGGAAACAGGTCTCGCTTT No data
Right 1072965934 10:99972648-99972670 TCACCCAGGCTGGAGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072965931 Original CRISPR AAAGCGAGACCTGTTTCCCC CGG (reversed) Intronic