ID: 1072966423

View in Genome Browser
Species Human (GRCh38)
Location 10:99977139-99977161
Sequence TGCACTCATTCCAATGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072966423_1072966426 7 Left 1072966423 10:99977139-99977161 CCTACTCCATTGGAATGAGTGCA 0: 1
1: 0
2: 1
3: 8
4: 86
Right 1072966426 10:99977169-99977191 TGAGGAGCACACACCCTAGAAGG No data
1072966423_1072966430 22 Left 1072966423 10:99977139-99977161 CCTACTCCATTGGAATGAGTGCA 0: 1
1: 0
2: 1
3: 8
4: 86
Right 1072966430 10:99977184-99977206 CTAGAAGGGTACTGAAGTCACGG No data
1072966423_1072966427 8 Left 1072966423 10:99977139-99977161 CCTACTCCATTGGAATGAGTGCA 0: 1
1: 0
2: 1
3: 8
4: 86
Right 1072966427 10:99977170-99977192 GAGGAGCACACACCCTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072966423 Original CRISPR TGCACTCATTCCAATGGAGT AGG (reversed) Intronic
900876174 1:5344017-5344039 TTAACTCATTCCCATGGAGGAGG - Intergenic
905383004 1:37577446-37577468 TGCTGTCATTCTAGTGGAGTTGG - Intronic
905666138 1:39764187-39764209 TGCCCTCCTTCCCAGGGAGTCGG - Intronic
906621203 1:47281112-47281134 TTCACCATTTCCAATGGAGTAGG + Exonic
910865987 1:91788373-91788395 TTCACTCATTCCAGTGGAGCAGG + Intronic
911171043 1:94771487-94771509 TGAACTCATTTCAGTGGATTTGG - Intergenic
915864122 1:159479604-159479626 TGCCCTTATTCCAATGGGGCTGG - Intergenic
918924598 1:190765922-190765944 TTCACTCATTCCCATGGCGTAGG + Intergenic
921714600 1:218404921-218404943 TGCATGCTTTCAAATGGAGTTGG + Intronic
922589305 1:226762315-226762337 TATACTCATTCCAATGTGGTAGG + Intergenic
1063911273 10:10832799-10832821 TGCATTCATTACACTGGAATCGG + Intergenic
1065867476 10:29926539-29926561 TGCACTCATTACCATGGAGATGG + Intergenic
1069091908 10:64209693-64209715 TGCACTGATTCCAAAGGCCTTGG - Intergenic
1069626312 10:69869720-69869742 AGCACTGATGCCAATGGATTGGG - Intronic
1069914647 10:71779936-71779958 TTCACTCATTACTATAGAGTGGG + Intronic
1072966423 10:99977139-99977161 TGCACTCATTCCAATGGAGTAGG - Intronic
1074209321 10:111314905-111314927 TGCCCACTTTCTAATGGAGTTGG - Intergenic
1076524020 10:131099583-131099605 TACACTCATGCCAAATGAGTGGG + Intronic
1081034485 11:38125121-38125143 TGGAATTATTCCAATAGAGTGGG - Intergenic
1087940883 11:104095388-104095410 ACCACTCATTCCACTGAAGTAGG + Intronic
1097701274 12:62822468-62822490 AGCACTTATTCCAAAAGAGTTGG + Intronic
1099798126 12:87423194-87423216 TTCACTCTTTCCAAAGGAGAGGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1107194090 13:37626668-37626690 TGAACTCATTACAATGGGGAGGG - Intergenic
1117268074 14:54111840-54111862 AGCAGTCATTCCTATGGAGGGGG - Intergenic
1123573555 15:21641774-21641796 TGGTCTGCTTCCAATGGAGTTGG - Intergenic
1123610175 15:22084390-22084412 TGGTCTGCTTCCAATGGAGTTGG - Intergenic
1125676315 15:41504205-41504227 TTCACTCCTGCCAATGGAGCTGG - Exonic
1129514042 15:76145801-76145823 TGCTTTCATTCCAATGCAGTTGG + Intronic
1202982423 15_KI270727v1_random:376187-376209 TGGTCTGCTTCCAATGGAGTTGG - Intergenic
1135012991 16:18900713-18900735 TGCACTAAAGCCAATGAAGTAGG + Intronic
1135319912 16:21488285-21488307 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135372748 16:21919772-21919794 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135439034 16:22450929-22450951 TGCACTAAAGCCAATGAAGTAGG - Intergenic
1136330143 16:29569997-29570019 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1136444768 16:30309702-30309724 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1140623235 16:76762177-76762199 TGCACTCATTGCCATGGGGATGG - Intergenic
1141497934 16:84422775-84422797 GCCACTCATTCCTAAGGAGTAGG - Intronic
1145224104 17:21113509-21113531 TGACCTCATTCCTTTGGAGTTGG + Intergenic
1157231024 18:45916169-45916191 AGCACTCAGCCCAATGAAGTGGG - Exonic
1159354896 18:67325861-67325883 AGCAATTTTTCCAATGGAGTTGG - Intergenic
1160039795 18:75335174-75335196 TGCAGTCATGCCAATGGTGCAGG + Intergenic
1163692898 19:18746771-18746793 TGCACCCCTTCCAAGGGAGGGGG - Intronic
925385238 2:3457597-3457619 TGCAATCATTCCAAATGAGAAGG - Intronic
926865608 2:17354489-17354511 TCCAGTGTTTCCAATGGAGTAGG + Intergenic
932608849 2:73183625-73183647 TCCACTCAATCCAGTGAAGTGGG + Intergenic
933293603 2:80465046-80465068 AGCTCTCATCCCAATGGAGCAGG - Intronic
933639754 2:84746968-84746990 TTCACTCATTTCTATGGAGAGGG + Intronic
941919312 2:170833300-170833322 TGCACTTATTCCAGTGGTGTTGG - Intronic
945477494 2:210302405-210302427 TAAACTCATCCCAAGGGAGTTGG + Intronic
1178678211 21:34648895-34648917 TGCAATCATGCCAGTGGAGTGGG + Intergenic
1181990369 22:26832426-26832448 GGGACTCATTCCAAAGGTGTGGG - Intergenic
1182043400 22:27255811-27255833 TGCAATCATACCAACGTAGTTGG - Intergenic
1182172157 22:28242218-28242240 TTTACTCCTTCTAATGGAGTGGG + Intronic
960275701 3:115726877-115726899 GGCACTGATTCCATCGGAGTGGG - Intergenic
964643882 3:158937244-158937266 GGCACCCACTCCAATGGAGGTGG - Intergenic
965009911 3:163074101-163074123 TGCACTGACTGCAGTGGAGTGGG - Intergenic
965478102 3:169183261-169183283 TGCACTCATTGCCATAGGGTAGG + Intronic
969718802 4:8881785-8881807 TGCACTCATTTCCATGGTGGTGG + Intergenic
971760498 4:30758823-30758845 TGCAGTTATTCTAATTGAGTAGG + Intronic
972076905 4:35101299-35101321 TGCTTCCATTCAAATGGAGTGGG - Intergenic
974636638 4:64572393-64572415 TGGACTCATTCTAATGGGGCAGG - Intergenic
977671172 4:99697492-99697514 TGCATTGATTCCTCTGGAGTAGG + Intergenic
981760738 4:148192362-148192384 AGCACTTATTCCAGTGGAGGTGG + Intronic
987169394 5:15238546-15238568 TTCATTCATTCCAAAGGGGTTGG + Intergenic
987795847 5:22625962-22625984 TGCACACATGCCATTGGAGGAGG - Intronic
988191111 5:27936045-27936067 TTCTCTCATTCCAACAGAGTAGG + Intergenic
989623243 5:43405222-43405244 TGCACTTATTCCAAAATAGTTGG + Intronic
1002450418 5:179315362-179315384 TGCACTCCTGCCAGTGAAGTGGG + Intronic
1007161564 6:39795370-39795392 TGCACTCTTTCCATTGTTGTCGG - Intronic
1008882627 6:56395872-56395894 TGCACTGTCTCCTATGGAGTTGG - Intergenic
1013531962 6:111027963-111027985 TGTATTCATTTCAATGGAGGTGG + Intronic
1014852787 6:126362050-126362072 TGCACACACTTCTATGGAGTGGG + Intergenic
1015089084 6:129332178-129332200 TCCACTCATTACTATGGTGTGGG + Intronic
1015295502 6:131586713-131586735 GACACTCATTCCAATGGAGTCGG + Exonic
1019882724 7:3877136-3877158 TTTATTCATTCCAATGGATTGGG - Intronic
1038063547 8:23938196-23938218 TGCTCTCATTTCACTGGGGTTGG + Intergenic
1038213076 8:25538053-25538075 TGCTTTCATTCAAATGGTGTAGG + Intergenic
1039835516 8:41253433-41253455 TGCACTCATTCCAATATATTTGG - Intergenic
1041941242 8:63390468-63390490 GGCACTGATGACAATGGAGTGGG - Intergenic
1046854673 8:119017501-119017523 TGCACTCATTCCCACAGAGCTGG - Intronic
1055723178 9:79198304-79198326 TGGACTGAATCCAATGGAGAAGG - Intergenic
1055818258 9:80232357-80232379 TGCACAGATTACAATGCAGTGGG - Intergenic
1057078282 9:92152616-92152638 TACACTCATGCCAAGTGAGTGGG + Intergenic
1057106490 9:92422671-92422693 TGCACTTAATCAAAGGGAGTGGG - Intronic
1057913005 9:99034806-99034828 TGCACTCATTTGAATGCATTTGG - Intronic
1186280907 X:7992061-7992083 TTCCATCAGTCCAATGGAGTAGG + Intergenic
1188642716 X:32526043-32526065 TGGACTGATTCCAAAGGTGTAGG - Intronic
1189053842 X:37677454-37677476 TGCACTCATTGCAATAAAGTAGG + Intronic
1189774516 X:44458396-44458418 TTCACTCATTTCATTGGAATAGG - Intergenic
1193265659 X:79465043-79465065 TTCACTATTTCCTATGGAGTTGG - Intergenic
1197650676 X:129060226-129060248 TGAACTCATTACCATGGAGAGGG - Intergenic
1199496727 X:148460307-148460329 GGCTCTGAATCCAATGGAGTAGG + Intergenic
1199596576 X:149510742-149510764 TGCATTCATCTGAATGGAGTGGG + Intronic
1199994173 X:153009296-153009318 TTCAGTCTTTCCAATGGACTAGG - Intergenic
1201308017 Y:12567770-12567792 TGCTTCCATTCAAATGGAGTGGG - Intergenic