ID: 1072969799

View in Genome Browser
Species Human (GRCh38)
Location 10:100007418-100007440
Sequence CATACAGGTGTTCCTCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072969789_1072969799 14 Left 1072969789 10:100007381-100007403 CCACGACCCCGGCACACACAGGT 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1072969799 10:100007418-100007440 CATACAGGTGTTCCTCCTCCCGG No data
1072969790_1072969799 8 Left 1072969790 10:100007387-100007409 CCCCGGCACACACAGGTGCCCCC 0: 1
1: 0
2: 6
3: 26
4: 262
Right 1072969799 10:100007418-100007440 CATACAGGTGTTCCTCCTCCCGG No data
1072969791_1072969799 7 Left 1072969791 10:100007388-100007410 CCCGGCACACACAGGTGCCCCCC 0: 1
1: 1
2: 2
3: 30
4: 315
Right 1072969799 10:100007418-100007440 CATACAGGTGTTCCTCCTCCCGG No data
1072969792_1072969799 6 Left 1072969792 10:100007389-100007411 CCGGCACACACAGGTGCCCCCCA No data
Right 1072969799 10:100007418-100007440 CATACAGGTGTTCCTCCTCCCGG No data
1072969794_1072969799 -10 Left 1072969794 10:100007405-100007427 CCCCCCACAAGCACATACAGGTG 0: 1
1: 0
2: 1
3: 16
4: 238
Right 1072969799 10:100007418-100007440 CATACAGGTGTTCCTCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072969799 Original CRISPR CATACAGGTGTTCCTCCTCC CGG Intronic
No off target data available for this crispr