ID: 1072969942

View in Genome Browser
Species Human (GRCh38)
Location 10:100009252-100009274
Sequence ACCGGGCATCTGTGTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072969942_1072969951 17 Left 1072969942 10:100009252-100009274 CCTTTGAGACACAGATGCCCGGT No data
Right 1072969951 10:100009292-100009314 GCAGGAACGCGGGTGTCCGCGGG No data
1072969942_1072969947 6 Left 1072969942 10:100009252-100009274 CCTTTGAGACACAGATGCCCGGT No data
Right 1072969947 10:100009281-100009303 CTGTGCCTGCAGCAGGAACGCGG No data
1072969942_1072969950 16 Left 1072969942 10:100009252-100009274 CCTTTGAGACACAGATGCCCGGT No data
Right 1072969950 10:100009291-100009313 AGCAGGAACGCGGGTGTCCGCGG No data
1072969942_1072969948 7 Left 1072969942 10:100009252-100009274 CCTTTGAGACACAGATGCCCGGT No data
Right 1072969948 10:100009282-100009304 TGTGCCTGCAGCAGGAACGCGGG No data
1072969942_1072969946 -1 Left 1072969942 10:100009252-100009274 CCTTTGAGACACAGATGCCCGGT No data
Right 1072969946 10:100009274-100009296 TGGACATCTGTGCCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072969942 Original CRISPR ACCGGGCATCTGTGTCTCAA AGG (reversed) Intronic