ID: 1072969945

View in Genome Browser
Species Human (GRCh38)
Location 10:100009270-100009292
Sequence CTGCAGGCACAGATGTCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072969945_1072969951 -1 Left 1072969945 10:100009270-100009292 CCGGTGGACATCTGTGCCTGCAG No data
Right 1072969951 10:100009292-100009314 GCAGGAACGCGGGTGTCCGCGGG No data
1072969945_1072969950 -2 Left 1072969945 10:100009270-100009292 CCGGTGGACATCTGTGCCTGCAG No data
Right 1072969950 10:100009291-100009313 AGCAGGAACGCGGGTGTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072969945 Original CRISPR CTGCAGGCACAGATGTCCAC CGG (reversed) Intronic