ID: 1072969946

View in Genome Browser
Species Human (GRCh38)
Location 10:100009274-100009296
Sequence TGGACATCTGTGCCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072969940_1072969946 0 Left 1072969940 10:100009251-100009273 CCCTTTGAGACACAGATGCCCGG No data
Right 1072969946 10:100009274-100009296 TGGACATCTGTGCCTGCAGCAGG No data
1072969942_1072969946 -1 Left 1072969942 10:100009252-100009274 CCTTTGAGACACAGATGCCCGGT No data
Right 1072969946 10:100009274-100009296 TGGACATCTGTGCCTGCAGCAGG No data
1072969938_1072969946 26 Left 1072969938 10:100009225-100009247 CCTTTACTAAAGTGACAGCATCA No data
Right 1072969946 10:100009274-100009296 TGGACATCTGTGCCTGCAGCAGG No data
1072969939_1072969946 3 Left 1072969939 10:100009248-100009270 CCACCCTTTGAGACACAGATGCC No data
Right 1072969946 10:100009274-100009296 TGGACATCTGTGCCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072969946 Original CRISPR TGGACATCTGTGCCTGCAGC AGG Intronic