ID: 1072969947

View in Genome Browser
Species Human (GRCh38)
Location 10:100009281-100009303
Sequence CTGTGCCTGCAGCAGGAACG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072969942_1072969947 6 Left 1072969942 10:100009252-100009274 CCTTTGAGACACAGATGCCCGGT No data
Right 1072969947 10:100009281-100009303 CTGTGCCTGCAGCAGGAACGCGG No data
1072969940_1072969947 7 Left 1072969940 10:100009251-100009273 CCCTTTGAGACACAGATGCCCGG No data
Right 1072969947 10:100009281-100009303 CTGTGCCTGCAGCAGGAACGCGG No data
1072969939_1072969947 10 Left 1072969939 10:100009248-100009270 CCACCCTTTGAGACACAGATGCC No data
Right 1072969947 10:100009281-100009303 CTGTGCCTGCAGCAGGAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072969947 Original CRISPR CTGTGCCTGCAGCAGGAACG CGG Intronic