ID: 1072969951

View in Genome Browser
Species Human (GRCh38)
Location 10:100009292-100009314
Sequence GCAGGAACGCGGGTGTCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072969939_1072969951 21 Left 1072969939 10:100009248-100009270 CCACCCTTTGAGACACAGATGCC No data
Right 1072969951 10:100009292-100009314 GCAGGAACGCGGGTGTCCGCGGG No data
1072969942_1072969951 17 Left 1072969942 10:100009252-100009274 CCTTTGAGACACAGATGCCCGGT No data
Right 1072969951 10:100009292-100009314 GCAGGAACGCGGGTGTCCGCGGG No data
1072969944_1072969951 0 Left 1072969944 10:100009269-100009291 CCCGGTGGACATCTGTGCCTGCA No data
Right 1072969951 10:100009292-100009314 GCAGGAACGCGGGTGTCCGCGGG No data
1072969945_1072969951 -1 Left 1072969945 10:100009270-100009292 CCGGTGGACATCTGTGCCTGCAG No data
Right 1072969951 10:100009292-100009314 GCAGGAACGCGGGTGTCCGCGGG No data
1072969940_1072969951 18 Left 1072969940 10:100009251-100009273 CCCTTTGAGACACAGATGCCCGG No data
Right 1072969951 10:100009292-100009314 GCAGGAACGCGGGTGTCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072969951 Original CRISPR GCAGGAACGCGGGTGTCCGC GGG Intronic