ID: 1072975913

View in Genome Browser
Species Human (GRCh38)
Location 10:100057616-100057638
Sequence GGGTAGGCCTAGTACTGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072975905_1072975913 14 Left 1072975905 10:100057579-100057601 CCAGTAAGGGGGGAAATAGGATG 0: 2
1: 0
2: 0
3: 4
4: 95
Right 1072975913 10:100057616-100057638 GGGTAGGCCTAGTACTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072975913 Original CRISPR GGGTAGGCCTAGTACTGTAG GGG Intronic
No off target data available for this crispr