ID: 1072978971

View in Genome Browser
Species Human (GRCh38)
Location 10:100083684-100083706
Sequence GTTCTATTGGGTACATACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072978971_1072978976 21 Left 1072978971 10:100083684-100083706 CCTGGGTATGTACCCAATAGAAC No data
Right 1072978976 10:100083728-100083750 ACAGCAGCATTATTCATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072978971 Original CRISPR GTTCTATTGGGTACATACCC AGG (reversed) Intergenic
No off target data available for this crispr