ID: 1072984796

View in Genome Browser
Species Human (GRCh38)
Location 10:100130245-100130267
Sequence ATGAATGCACCACTGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072984792_1072984796 3 Left 1072984792 10:100130219-100130241 CCAGGAGGTCAGGGCCTCAGTGA No data
Right 1072984796 10:100130245-100130267 ATGAATGCACCACTGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072984796 Original CRISPR ATGAATGCACCACTGCAGCA GGG Intergenic
No off target data available for this crispr