ID: 1072985008

View in Genome Browser
Species Human (GRCh38)
Location 10:100131707-100131729
Sequence TGAAAAGCACCAGAATTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072985008_1072985017 29 Left 1072985008 10:100131707-100131729 CCCTGTAATTCTGGTGCTTTTCA No data
Right 1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG No data
1072985008_1072985018 30 Left 1072985008 10:100131707-100131729 CCCTGTAATTCTGGTGCTTTTCA No data
Right 1072985018 10:100131760-100131782 TCAGTGTGAAGTGCGTGGATGGG No data
1072985008_1072985016 25 Left 1072985008 10:100131707-100131729 CCCTGTAATTCTGGTGCTTTTCA No data
Right 1072985016 10:100131755-100131777 GTGTGTCAGTGTGAAGTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072985008 Original CRISPR TGAAAAGCACCAGAATTACA GGG (reversed) Intergenic
No off target data available for this crispr