ID: 1072985012

View in Genome Browser
Species Human (GRCh38)
Location 10:100131742-100131764
Sequence ACTGACACACTAGGGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072985012_1072985016 -10 Left 1072985012 10:100131742-100131764 CCTCCACACCCTAGTGTGTCAGT No data
Right 1072985016 10:100131755-100131777 GTGTGTCAGTGTGAAGTGCGTGG No data
1072985012_1072985019 14 Left 1072985012 10:100131742-100131764 CCTCCACACCCTAGTGTGTCAGT No data
Right 1072985019 10:100131779-100131801 TGGGTTGCATAATTGCATAGTGG No data
1072985012_1072985020 15 Left 1072985012 10:100131742-100131764 CCTCCACACCCTAGTGTGTCAGT No data
Right 1072985020 10:100131780-100131802 GGGTTGCATAATTGCATAGTGGG No data
1072985012_1072985017 -6 Left 1072985012 10:100131742-100131764 CCTCCACACCCTAGTGTGTCAGT No data
Right 1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG No data
1072985012_1072985018 -5 Left 1072985012 10:100131742-100131764 CCTCCACACCCTAGTGTGTCAGT No data
Right 1072985018 10:100131760-100131782 TCAGTGTGAAGTGCGTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072985012 Original CRISPR ACTGACACACTAGGGTGTGG AGG (reversed) Intergenic
No off target data available for this crispr