ID: 1072985014

View in Genome Browser
Species Human (GRCh38)
Location 10:100131750-100131772
Sequence CACTTCACACTGACACACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072985014_1072985020 7 Left 1072985014 10:100131750-100131772 CCCTAGTGTGTCAGTGTGAAGTG No data
Right 1072985020 10:100131780-100131802 GGGTTGCATAATTGCATAGTGGG No data
1072985014_1072985019 6 Left 1072985014 10:100131750-100131772 CCCTAGTGTGTCAGTGTGAAGTG No data
Right 1072985019 10:100131779-100131801 TGGGTTGCATAATTGCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072985014 Original CRISPR CACTTCACACTGACACACTA GGG (reversed) Intergenic
No off target data available for this crispr