ID: 1072985015

View in Genome Browser
Species Human (GRCh38)
Location 10:100131751-100131773
Sequence GCACTTCACACTGACACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072985015_1072985019 5 Left 1072985015 10:100131751-100131773 CCTAGTGTGTCAGTGTGAAGTGC No data
Right 1072985019 10:100131779-100131801 TGGGTTGCATAATTGCATAGTGG No data
1072985015_1072985020 6 Left 1072985015 10:100131751-100131773 CCTAGTGTGTCAGTGTGAAGTGC No data
Right 1072985020 10:100131780-100131802 GGGTTGCATAATTGCATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072985015 Original CRISPR GCACTTCACACTGACACACT AGG (reversed) Intergenic
No off target data available for this crispr