ID: 1072985017

View in Genome Browser
Species Human (GRCh38)
Location 10:100131759-100131781
Sequence GTCAGTGTGAAGTGCGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072985009_1072985017 28 Left 1072985009 10:100131708-100131730 CCTGTAATTCTGGTGCTTTTCAA No data
Right 1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG No data
1072985008_1072985017 29 Left 1072985008 10:100131707-100131729 CCCTGTAATTCTGGTGCTTTTCA No data
Right 1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG No data
1072985013_1072985017 -9 Left 1072985013 10:100131745-100131767 CCACACCCTAGTGTGTCAGTGTG No data
Right 1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG No data
1072985012_1072985017 -6 Left 1072985012 10:100131742-100131764 CCTCCACACCCTAGTGTGTCAGT No data
Right 1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG No data
1072985011_1072985017 -5 Left 1072985011 10:100131741-100131763 CCCTCCACACCCTAGTGTGTCAG No data
Right 1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072985017 Original CRISPR GTCAGTGTGAAGTGCGTGGA TGG Intergenic
No off target data available for this crispr