ID: 1072985020

View in Genome Browser
Species Human (GRCh38)
Location 10:100131780-100131802
Sequence GGGTTGCATAATTGCATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072985015_1072985020 6 Left 1072985015 10:100131751-100131773 CCTAGTGTGTCAGTGTGAAGTGC No data
Right 1072985020 10:100131780-100131802 GGGTTGCATAATTGCATAGTGGG No data
1072985013_1072985020 12 Left 1072985013 10:100131745-100131767 CCACACCCTAGTGTGTCAGTGTG No data
Right 1072985020 10:100131780-100131802 GGGTTGCATAATTGCATAGTGGG No data
1072985011_1072985020 16 Left 1072985011 10:100131741-100131763 CCCTCCACACCCTAGTGTGTCAG No data
Right 1072985020 10:100131780-100131802 GGGTTGCATAATTGCATAGTGGG No data
1072985012_1072985020 15 Left 1072985012 10:100131742-100131764 CCTCCACACCCTAGTGTGTCAGT No data
Right 1072985020 10:100131780-100131802 GGGTTGCATAATTGCATAGTGGG No data
1072985014_1072985020 7 Left 1072985014 10:100131750-100131772 CCCTAGTGTGTCAGTGTGAAGTG No data
Right 1072985020 10:100131780-100131802 GGGTTGCATAATTGCATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072985020 Original CRISPR GGGTTGCATAATTGCATAGT GGG Intergenic
No off target data available for this crispr