ID: 1072990410

View in Genome Browser
Species Human (GRCh38)
Location 10:100186947-100186969
Sequence ATTAGATTCTCACAGGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 2, 1: 4, 2: 46, 3: 90, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072990407_1072990410 -4 Left 1072990407 10:100186928-100186950 CCACTTCAGATCATCAGGCATTA 0: 85
1: 970
2: 1043
3: 594
4: 375
Right 1072990410 10:100186947-100186969 ATTAGATTCTCACAGGGAGCCGG 0: 2
1: 4
2: 46
3: 90
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072990410 Original CRISPR ATTAGATTCTCACAGGGAGC CGG Exonic
900468413 1:2837450-2837472 ATTCGATTCTCACAGGAGCCAGG - Intergenic
901581503 1:10247896-10247918 GTTAGATTCTCATAAGGAGCGGG + Intronic
902313444 1:15599647-15599669 GTTAGATTCTCATAAGGAGTGGG + Intergenic
903322740 1:22552605-22552627 ATCAGACTCTCAGGGGGAGCGGG - Intergenic
903636099 1:24817861-24817883 ATTATTTTGTCTCAGGGAGCAGG + Intronic
904294659 1:29511506-29511528 GTTAGATTTTCATAAGGAGCAGG + Intergenic
904789233 1:33006114-33006136 ATTAGATTCTCACAAGGAGCGGG + Intergenic
904811535 1:33166112-33166134 ATTAGATTCTCATAAGGAGCAGG - Intronic
904908526 1:33916607-33916629 ATGAGCTTCTCACAGGAAGCTGG - Intronic
905082897 1:35340565-35340587 ATTAGATTCTCATAATGGGCAGG + Intronic
906089879 1:43169928-43169950 ATTAGATTCTCATAAGGAGCAGG - Intronic
906945393 1:50290267-50290289 GGAAGATTCTCACAGGGAGTGGG - Intergenic
908172203 1:61516459-61516481 GTTAGATTCTCATAAGGAGCAGG - Intergenic
909235388 1:73146795-73146817 ATTAGATTCTCATAAGAAGCAGG - Intergenic
909660489 1:78076493-78076515 ATTAGATTATCATAAGGTGCAGG + Intronic
910545224 1:88408316-88408338 ATTAGATTCTCATAAGAAGCAGG + Intergenic
910868927 1:91813876-91813898 GTGAGATTCTCATAAGGAGCAGG + Intronic
911057914 1:93723519-93723541 AGGAGACTCTCCCAGGGAGCTGG - Intronic
911147059 1:94562557-94562579 ATTAGACTCTCATAAGGAGCGGG + Intergenic
911494678 1:98616599-98616621 ATTAGATTCTCATAAGAAGGGGG - Intergenic
911898198 1:103466873-103466895 ATTAGATTCTCATAAGGAGTGGG + Intergenic
912062580 1:105690975-105690997 ATTAGATTGTCATAAGGAGCAGG - Intergenic
912248355 1:107984742-107984764 ATTAGATATTCACAAAGAGCTGG + Intergenic
913579427 1:120211051-120211073 ATTAGATCCTCATAAGAAGCAGG - Intergenic
913628745 1:120687337-120687359 ATTAGATCCTCATAAGAAGCAGG + Intergenic
917475218 1:175363492-175363514 ATTACATTCACCCAGAGAGCAGG - Intronic
918762744 1:188434771-188434793 ATTAGATTCTTATAAGGAGTGGG + Intergenic
921006001 1:211094192-211094214 ATTAGATTCTCATAAGGAGCAGG + Intronic
922111858 1:222566623-222566645 ATTAGATTCTCATAGGAGCCCGG - Intronic
923277896 1:232414615-232414637 ATGAGAGTCTCACAGAGCGCAGG + Intronic
924028212 1:239860119-239860141 ATTAGAATTTCTCAGGGAGTTGG + Intronic
924072744 1:240298675-240298697 ATTAGGTTCTCATAAAGAGCAGG - Intronic
924178947 1:241422043-241422065 ATTCTATTTTCACAGGCAGCAGG + Intergenic
1065281567 10:24144209-24144231 ATGAGATTCACACATGGAGAAGG - Intronic
1065931554 10:30483766-30483788 ATTAGATTTTCATAAGGAGCAGG - Intergenic
1066280574 10:33913779-33913801 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1067537774 10:47127287-47127309 AGAAGAGTCTCACAGGCAGCAGG - Intergenic
1068514400 10:58008198-58008220 ATTAGATTCTCCCAGAGAGTAGG - Intergenic
1069358450 10:67614493-67614515 ATTAGATTCTCATAAGGAGTAGG + Intronic
1069542658 10:69307098-69307120 ACTTGATTCTCATAGGCAGCTGG + Intronic
1070416620 10:76196349-76196371 ATTAGAAGCTCTCAGAGAGCAGG + Intronic
1070842722 10:79498786-79498808 GTAAGATTCTCATAAGGAGCCGG - Intergenic
1072030141 10:91511682-91511704 ATTAGATTCTCATAGGAACAAGG - Intronic
1072672305 10:97439489-97439511 ATTAGATTCTCATAAGGAGTGGG - Intronic
1072990410 10:100186947-100186969 ATTAGATTCTCACAGGGAGCCGG + Exonic
1073199932 10:101727117-101727139 GTTAGATTCTCATAAGGAGTGGG + Intergenic
1074409641 10:113215465-113215487 ATTGAATTCTCAGAAGGAGCAGG - Intergenic
1074821931 10:117186132-117186154 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1075880622 10:125847799-125847821 ATTAGATTCTCATAAGGAGCGGG + Intronic
1075927840 10:126267510-126267532 ATTAGATTCTCATAAGGAGCAGG + Intronic
1075977939 10:126713018-126713040 ATTAGATTCTTATAAGGAGAGGG - Intergenic
1075993447 10:126857549-126857571 ATTAGATCCTCACAAGGAGCTGG - Intergenic
1076201340 10:128561067-128561089 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1076621221 10:131789382-131789404 ATTAGATTCTCATAAGCAGTGGG - Intergenic
1077468285 11:2744161-2744183 AAGAGATTATTACAGGGAGCTGG + Intronic
1078878352 11:15421728-15421750 ATTACATTCTCTTAGGGAGCTGG - Intergenic
1078935049 11:15942477-15942499 ATTTGATTCTCACAGAGGGAGGG - Intergenic
1080014384 11:27489404-27489426 ATTAGATTCTCACAACAAGTGGG + Intergenic
1080546141 11:33320705-33320727 ATTTGATTCTCACAGGTTGTGGG + Intronic
1083129063 11:60606045-60606067 ATGAGATTCTCACAGAAACCTGG - Intergenic
1084158888 11:67333637-67333659 ATTAGATTCTCATAAGGAGCTGG - Intronic
1084768818 11:71329542-71329564 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1085503899 11:77044911-77044933 AGTAGATTCTCATAAGGAGCAGG + Intergenic
1085938254 11:81176751-81176773 ATTAGATTCTCATAAGGAGTGGG + Intergenic
1087530671 11:99377070-99377092 ATTAAATTCTGTCAGGAAGCGGG + Intronic
1087656472 11:100929184-100929206 GTTAGATTCTCATAAGGAGCAGG + Intronic
1089166889 11:116484216-116484238 GTAAGAATCTCCCAGGGAGCAGG - Intergenic
1090338887 11:125997559-125997581 ATTAGATTTTCACAGAGGACAGG - Intronic
1090485386 11:127107970-127107992 ATTAGATTCTTATAAGGAGCAGG - Intergenic
1090738239 11:129631336-129631358 ATTATATTATGACAGAGAGCAGG + Intergenic
1091936069 12:4435378-4435400 GTTAGATTCTCAGAAGGAGCAGG - Intronic
1092405436 12:8218943-8218965 ATTAGAGCCTCACAGGCACCTGG - Intergenic
1094344124 12:29448136-29448158 ACTAGATTATCATAAGGAGCAGG + Intronic
1096061320 12:48703037-48703059 ATTAGATTCTCATAAAGAGCAGG - Intronic
1097046028 12:56188753-56188775 AACAGAATCTCTCAGGGAGCCGG - Intronic
1097050114 12:56217805-56217827 ATTAGATTCTCATAGGGAGTGGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099089885 12:78292983-78293005 ATTACATTCTCATAGGAAGCAGG - Intergenic
1099134720 12:78881802-78881824 ATCAGCTTCTCAAAGAGAGCTGG - Intronic
1099456299 12:82866604-82866626 ATTTGATTCCCCCAGGCAGCAGG - Intronic
1100092792 12:90992133-90992155 ATTAGATTCTCATAAGAAGCAGG + Intronic
1100324827 12:93531016-93531038 ATTAGATTTTCATAAGGAGCGGG + Intergenic
1100715662 12:97302565-97302587 ATTAGATGCTCATAAGGAGTGGG + Intergenic
1100772938 12:97943337-97943359 ATTTGAGTCTCATAGGAAGCTGG - Intergenic
1104188843 12:126458464-126458486 ATGAGGTTCTCACAGCTAGCTGG - Intergenic
1104624557 12:130340426-130340448 ATTAGATTCTCATAAGGAGCAGG + Intronic
1104680302 12:130746531-130746553 ATTGGATTCTCCTAAGGAGCAGG + Intergenic
1104824420 12:131698585-131698607 ATTAGATTATCACAGGAGGCCGG + Intergenic
1105972932 13:25447490-25447512 ATGGGAAGCTCACAGGGAGCAGG + Intronic
1107124884 13:36836333-36836355 ATTAGATTTTCAAAGGCAACCGG - Intergenic
1107506606 13:41040579-41040601 ATTAGATTCTCTTAGGAAGCAGG + Intronic
1107797195 13:44064921-44064943 ACTAGATTCTCATAAGGAGCAGG + Intergenic
1108588879 13:51894947-51894969 GTTAGATTCTCATAAGGAGTGGG + Intergenic
1109373563 13:61458138-61458160 ATTAGATTCTCATAAAGAGCAGG - Intergenic
1109831947 13:67802334-67802356 TGTAGAGCCTCACAGGGAGCCGG + Intergenic
1111225136 13:85260927-85260949 ATTAGACTCTTAAAGGGAGAAGG + Intergenic
1111592665 13:90370184-90370206 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1111683891 13:91477736-91477758 AGTGAATTCTCAGAGGGAGCGGG + Intronic
1112022507 13:95383956-95383978 ATTAGATTCTCATAAGGAGGGGG - Intergenic
1112032971 13:95474223-95474245 ATTAGATTCTGATAAGGAGGAGG + Intronic
1114890444 14:26915091-26915113 ATTAGATTCTCATAAAGAGCAGG + Intergenic
1116643538 14:47496936-47496958 ATTAGATTCTCATAAGGAGCAGG + Intronic
1116966078 14:51016395-51016417 ATTAGATTCTCATAAGGAGCGGG - Intronic
1117677429 14:58168970-58168992 ATAGCATTCTCACAGGGAGAAGG - Intronic
1119012147 14:71004489-71004511 ATTGGATTCTCATAAGGAGTGGG - Intronic
1119088975 14:71762720-71762742 ACTAGAGTCTCAGAGAGAGCAGG + Intergenic
1119121581 14:72084191-72084213 ATTAGATTCTCATAAGGAGTGGG + Intronic
1119122246 14:72090462-72090484 ATTAGATTCTCATAAGGAGCAGG - Intronic
1119203732 14:72778382-72778404 ATTAGATTCTCATAAGGAGTGGG - Intronic
1119772693 14:77230652-77230674 GTTAGAGTCTCATAAGGAGCAGG - Intronic
1122650758 14:103225312-103225334 ACTAGATTCTCCCACAGAGCTGG + Intergenic
1202833739 14_GL000009v2_random:62644-62666 ATTAGATTATGACAGGGAGAGGG + Intergenic
1202894258 14_KI270722v1_random:189074-189096 ATTAGATTATCATAAGGAGCAGG - Intergenic
1125453046 15:39828616-39828638 TTTTGATTCACTCAGGGAGCAGG + Intronic
1125860746 15:42997213-42997235 ATTAGATTTTCATAAGGAGTGGG - Intronic
1125975997 15:43952246-43952268 AATACATTCTATCAGGGAGCTGG + Intronic
1126434162 15:48618860-48618882 ATTAGATTCTCATAAGGAGTGGG - Intronic
1127884085 15:63183932-63183954 ATTAGATTCTCATAAGGAGTGGG - Intergenic
1128110546 15:65073402-65073424 ATTAGATTGTCATAAGGAGCAGG + Intronic
1128217209 15:65942800-65942822 ATTCTGTTCTCAGAGGGAGCAGG - Intronic
1128491038 15:68144758-68144780 ATCAAATTCTCAAAGGGATCAGG - Intronic
1128855954 15:71015390-71015412 ATTAGATTCTCATAAGGAGTGGG + Intronic
1130425813 15:83798289-83798311 ATTAGATGAGCTCAGGGAGCAGG - Intronic
1130516795 15:84631968-84631990 AGAAGATTCCCACTGGGAGCAGG + Intergenic
1131703948 15:94972384-94972406 ATTAGACTCATACAAGGAGCTGG + Intergenic
1132170814 15:99652263-99652285 ATTAGATTCTCATAAGGAATGGG + Intronic
1132659930 16:1056782-1056804 ACGAGGCTCTCACAGGGAGCGGG + Intergenic
1133227116 16:4346561-4346583 ACTACATTCCCTCAGGGAGCTGG + Intronic
1135191433 16:20357869-20357891 ATTAGATTCTCATAAGGAGCCGG + Intergenic
1135853335 16:25984317-25984339 ATTAGATTCTCATAAGGAGCAGG + Intronic
1138100968 16:54252223-54252245 ATTAGATTCTCATAAGGAGCAGG - Intronic
1138272881 16:55708769-55708791 ATGAGATACACTCAGGGAGCCGG + Intergenic
1138774866 16:59709076-59709098 ATTAGATTCTCATAGGTGCCCGG - Intergenic
1139962256 16:70724732-70724754 AGAAGATTCACACAAGGAGCTGG + Intronic
1140386474 16:74544423-74544445 AGGAGATTCTCACACGAAGCAGG - Intronic
1141281418 16:82632904-82632926 ATTAGACTCTCATAAGGAGAAGG + Intronic
1146168467 17:30612352-30612374 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1146221435 17:31025852-31025874 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1146393328 17:32442846-32442868 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1149086092 17:52717924-52717946 ATTAGACTCTTACAGGTGGCGGG + Intergenic
1149314707 17:55428108-55428130 ATTAGATTCTCATAAGGAGCGGG - Intergenic
1150366364 17:64589654-64589676 ATGAGAGTCTCATAAGGAGCTGG - Intronic
1151413425 17:73946235-73946257 ATTAGATTCTCATAAGAGGCTGG + Intergenic
1151573712 17:74940652-74940674 ATTAGATTCTCATGAGGAGTGGG - Intronic
1151636767 17:75354531-75354553 ATTAGATTCTTACAAGGAGCGGG - Intronic
1153144594 18:2016248-2016270 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1153342342 18:3988507-3988529 ATTAGATTCTCATAAGGAGCGGG + Intronic
1153853380 18:9118894-9118916 ATCAGATTGTCAAAGGGATCTGG - Intronic
1155394153 18:25368471-25368493 ATTAGATTCTCATAAGGAGCTGG + Intergenic
1155668759 18:28344071-28344093 ATTAGATTCTCATAACGAGCAGG + Intergenic
1155908308 18:31478860-31478882 ATTAGATTATCATAAGGAGCAGG + Intergenic
1156053033 18:32961651-32961673 ATTCGATTCTCATAAGGAGCAGG + Intronic
1156215739 18:34996333-34996355 ATTAGATTTTCATAAGCAGCGGG + Intronic
1157474055 18:48010120-48010142 GTTAGATCCTCATAAGGAGCAGG - Intergenic
1158421080 18:57294885-57294907 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1159853549 18:73556970-73556992 ATCAGATTCTCACTAGGAGGGGG - Intergenic
1161922088 19:7274190-7274212 GTTAGATTCTCATAAGGAGCAGG + Intronic
1163498572 19:17661943-17661965 ATTAGATTCTCATAGAAGGCCGG + Intronic
1165067588 19:33237984-33238006 TTTAGATGCTCACGGGGGGCAGG - Intergenic
1165479233 19:36052348-36052370 ATTAGATTCTCATAAAAAGCGGG - Intronic
1166017177 19:39991083-39991105 ATCAGATTCTCATAAGGAGCGGG + Intronic
1166233749 19:41441394-41441416 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1168255020 19:55160392-55160414 AGAATATTCTCACAGGGTGCTGG - Intronic
1202638933 1_KI270706v1_random:65048-65070 ATTAGATTATGACAGGGAGTGGG - Intergenic
925892983 2:8451075-8451097 ATTAGATTCTCATAAGGAGCAGG + Intergenic
926374746 2:12215359-12215381 ATTAGATTCTCACAAGGAGCAGG - Intergenic
927867746 2:26602379-26602401 ATTTGATTCTCACAGGGTTATGG + Intronic
928098678 2:28422083-28422105 ATTATATTCTTACAGGGATGAGG + Intergenic
929559475 2:42946804-42946826 ATTAGGTTCTCAGAGGCATCAGG - Intergenic
929770338 2:44886517-44886539 TCTAGGTTTTCACAGGGAGCTGG + Intergenic
930390050 2:50749335-50749357 TTTAGATTCTAACATAGAGCAGG - Intronic
930797168 2:55405742-55405764 ATTAGATTCTCATAAGGAGTGGG - Intronic
932026462 2:68138586-68138608 ATTAGATTCTCAAACGGATTTGG + Intronic
932098542 2:68874586-68874608 ATTGGATTCTCAAAGGGATCTGG + Intergenic
932480903 2:72038550-72038572 ACCAGAGTCTCACAGGGAGGAGG + Intergenic
932965572 2:76471187-76471209 ATGAGAGTCTCATAGGGAGATGG - Intergenic
933150585 2:78910393-78910415 ATGAGATTCACAATGGGAGCAGG - Intergenic
933227833 2:79771572-79771594 ATTAAATTCTCATAAGGATCTGG + Intronic
936094511 2:109521528-109521550 AGTAGATGATCACACGGAGCTGG + Intergenic
936912096 2:117603811-117603833 ATTATATTGTCAGAGGTAGCAGG - Intergenic
937014216 2:118588884-118588906 CTTAGATTCTCATAAGGAGGAGG + Intergenic
939296531 2:140272947-140272969 ACCAGATTCTCACAATGAGCAGG - Intronic
940646067 2:156394086-156394108 ATTAGATTCTTATAAGGAGCCGG + Intergenic
941040140 2:160612254-160612276 ATTAGATTTTCACAGGGCTTAGG + Intergenic
941350059 2:164420738-164420760 GTTAGATTCTCATAAGGAGCAGG + Intergenic
942565062 2:177257828-177257850 ATTAGATTGTCCTAAGGAGCTGG - Intronic
942633936 2:177981370-177981392 TTTACAGTCTCAAAGGGAGCAGG - Intronic
943120019 2:183724142-183724164 ATTAGATTCTCGTAAGGAACAGG - Intergenic
943244674 2:185431417-185431439 AATAGATTCTCATAAGGAGTAGG - Intergenic
943760297 2:191600800-191600822 ATAAGATTCTCAAAGGGATCTGG - Intergenic
944991605 2:205243822-205243844 ATTCGATTCTCACAACGACCTGG - Intronic
946596386 2:221310136-221310158 GTGAGATTCTCAGAGGGAGCAGG + Intergenic
947222077 2:227803524-227803546 ATAAAATTCTCACAGGGAGTAGG - Intergenic
947794884 2:232888038-232888060 TTTGGATGCTCACAAGGAGCTGG - Exonic
948654724 2:239469469-239469491 ATTAGATTCTCATAAGAGGCAGG + Intergenic
948788440 2:240365094-240365116 ACTACATTCTCCCAGGGAACTGG + Intergenic
1169580232 20:7014098-7014120 AAGAGAATCTCACAGCGAGCCGG + Intergenic
1170435533 20:16324211-16324233 AACAGATTTTTACAGGGAGCAGG + Intronic
1171404343 20:24899970-24899992 AGTGGCTTCTCACAGGCAGCTGG + Intergenic
1172590461 20:36114009-36114031 AATAGACTTTCACAGGCAGCTGG + Intronic
1172740295 20:37161278-37161300 ATTAGATTCTCTCTGGAATCTGG + Intronic
1173413243 20:42833799-42833821 ATTAGACATTCACACGGAGCGGG + Intronic
1174906470 20:54557333-54557355 ATTAGATTCTCATAAGGAGCAGG + Intronic
1177127419 21:17212821-17212843 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1178672948 21:34608002-34608024 ATTAGATTCTCATAAGGAGTGGG - Intronic
1179440117 21:41387770-41387792 ATTAGATGCTCAAAGGGCACTGG - Intronic
1180167792 21:46039002-46039024 ATCAGGGTCTCACTGGGAGCCGG + Intergenic
1180363018 22:11916815-11916837 ATTAGATTATGACAGGGAGTGGG + Intergenic
1183700946 22:39450629-39450651 ATCAGATTCTCAAAGGGAGCAGG - Intergenic
1185156510 22:49196327-49196349 ATGAGATTCTCACATAGACCTGG - Intergenic
950696514 3:14704848-14704870 ACAAGCTTCTCACAGGTAGCTGG - Intronic
951011187 3:17681968-17681990 GTTAGATTCTCATAAGGTGCAGG - Intronic
951457283 3:22906941-22906963 ATTAGAGTTTCACAGGAGGCTGG + Intergenic
952127974 3:30324432-30324454 CTAAGATTCTCAGAGGTAGCAGG + Intergenic
953861592 3:46548838-46548860 ATTAGATTCTCATAAGCAGTGGG + Intronic
955291995 3:57700803-57700825 ATTAGATTCTCCTAAGGAGCAGG + Intergenic
955572810 3:60326360-60326382 ATTAGGTTCTCATAAGGAGCGGG + Intronic
955698881 3:61663757-61663779 ATTAGAGCCTCATAAGGAGCGGG + Intronic
956287289 3:67624083-67624105 ATTAGATCCTTAGAAGGAGCAGG - Intronic
956438668 3:69259171-69259193 ACTAGATTCTCAAAAGGAGTAGG + Intronic
956585614 3:70861328-70861350 CTTAGACTCTGACAGGGATCTGG - Intergenic
956727492 3:72168448-72168470 ATTAGATTGTCATAAGGAGCGGG - Intergenic
957212787 3:77281806-77281828 AGTAGATTCTCATAAGGAGCAGG + Intronic
957377070 3:79371965-79371987 ATTAGATTCTCATAGGGAGCAGG + Intronic
958686936 3:97410522-97410544 ATTAGATGGTCACAGGGAAAGGG - Intronic
959638638 3:108605565-108605587 ATTAGATTCTCACAAGGAGTGGG + Intronic
961230536 3:125303564-125303586 ATTAGGTTCTCATAAGGAGCAGG - Intronic
962959499 3:140297449-140297471 ACTTGATTCTCACAATGAGCTGG + Intronic
964743447 3:159989946-159989968 TCTAGACCCTCACAGGGAGCTGG + Intronic
965518818 3:169652209-169652231 ATGAGATTCTCACAGGAGTCTGG + Intronic
965724905 3:171704902-171704924 GTTAGACTCTCATAAGGAGCGGG + Intronic
966158679 3:176945775-176945797 GTTAGATTCTCATAAGGAGCGGG - Intergenic
966363418 3:179154399-179154421 ATTAGATTCTCATTAGGAGCAGG - Intronic
966556817 3:181271656-181271678 ATTAGATCCCCATAAGGAGCAGG - Intergenic
966859001 3:184218086-184218108 GTTAGATTCTCATGAGGAGCAGG - Intronic
967208673 3:187147637-187147659 ATTAGATTACCATAAGGAGCGGG + Intronic
968034532 3:195535165-195535187 ATTAGACTCTCATAAGGAGTGGG + Intronic
969957045 4:10901610-10901632 AAAAGATTCTTACAGGCAGCAGG + Intergenic
971541095 4:27817624-27817646 ATTAGATTTTCATAAGGAACAGG - Intergenic
971599351 4:28572417-28572439 CTTAGATTCTTCCAGGGAGCAGG - Intergenic
972368645 4:38399823-38399845 ATTAGATTCTCACAAGGAGCAGG - Intergenic
972660468 4:41111040-41111062 ATTAGATTCTCATAACGAGTGGG + Intronic
973829844 4:54747626-54747648 ATTAGATTCTCATAAGAAGTGGG + Intergenic
974354484 4:60794705-60794727 GTTAAACTCTCACAAGGAGCGGG - Intergenic
974401723 4:61416976-61416998 ATTAGATTCTCATAAGAAACAGG + Intronic
974556280 4:63452736-63452758 ATGAGATTCTCCCAGAGAGAGGG - Intergenic
976034273 4:80796456-80796478 ATAAGATTATGACAGGAAGCTGG + Intronic
976508501 4:85879893-85879915 ATTAGATTCTCATAAGGAGCAGG + Intronic
976705605 4:88016012-88016034 GTGAGATTCTCATAAGGAGCAGG + Intronic
977810539 4:101350270-101350292 ATTAGATTCTCATAAGGAGCGGG + Intergenic
977910134 4:102524748-102524770 GTTAGATTCTCATAAGGAGCGGG + Intronic
978754496 4:112287301-112287323 ATTAGATTCTCATAAGAAGCGGG + Intronic
978830278 4:113075960-113075982 ATCAGATTCTCAGTGGGATCTGG - Intronic
979055147 4:115984174-115984196 ATTAGATTCTCATAAGGTGTGGG - Intergenic
979478257 4:121183766-121183788 ATTAGATTCTCATAAGGAGCAGG - Intronic
979623512 4:122821761-122821783 ATTAAATACTCACAGGAGGCTGG - Intergenic
980574275 4:134665656-134665678 GCTACAGTCTCACAGGGAGCTGG - Intergenic
980720090 4:136684326-136684348 ATCAGATTCTCAGAGGGAATTGG - Intergenic
981531509 4:145758764-145758786 AGGAGATGCCCACAGGGAGCGGG - Intronic
982171651 4:152667485-152667507 ACTTGATTCTCTCTGGGAGCAGG + Intronic
982282980 4:153704836-153704858 ATTTGTTTCTTACAGTGAGCGGG + Exonic
982560049 4:156918583-156918605 ATTAGATTCTCACAGGAACACGG + Intronic
983700114 4:170581480-170581502 GTTAGATTCTCATAAGGAGCAGG + Intergenic
984079817 4:175233422-175233444 ATTAGATTCTCATAAGGAGCGGG - Intergenic
1202766280 4_GL000008v2_random:150907-150929 ATTAGATTATGACAGGGAGTGGG - Intergenic
985870237 5:2548683-2548705 TTTAGATTTTCTCAGGGAGAAGG - Intergenic
986021421 5:3807605-3807627 ATTAGATTCTCCTAAGGAGTGGG - Intergenic
986293374 5:6417991-6418013 ATTAGATTCTCATTAGGAGCTGG - Intergenic
987530443 5:19112578-19112600 ATTATATTTCCACATGGAGCTGG + Intergenic
987835163 5:23151104-23151126 ATTAGATTATTATAAGGAGCGGG - Intergenic
988787298 5:34576910-34576932 ATGCGCTTCTCACAGTGAGCAGG - Intergenic
989737330 5:44724182-44724204 ATTAAATTCACACAGGGAAATGG + Intergenic
991316170 5:65309323-65309345 ATTAGATTCTCAGAAAGAGTGGG + Intronic
992096375 5:73366641-73366663 GTTAGATTCTCATAAGGAGCAGG + Intergenic
992151207 5:73905218-73905240 ATTAGATTCTCATAAGGAGGGGG - Intronic
992680564 5:79148944-79148966 CTTAGAGTCACACAGGCAGCTGG - Intronic
996061998 5:119042671-119042693 AATAGATTGTCCCAGGCAGCAGG + Intronic
996614356 5:125422631-125422653 TTTAGATTCTCACAAGGAGCAGG - Intergenic
997272672 5:132555003-132555025 ATTAGATTCTCATAAGGAATGGG + Intronic
997693868 5:135846158-135846180 ATCAGATTCTCATAAAGAGCGGG - Intronic
997959431 5:138307956-138307978 CTCAGATTCTCACAAGGAACCGG + Intronic
999463016 5:151772642-151772664 ATTTGATTCTTGCAGTGAGCTGG + Intronic
1000308759 5:160020699-160020721 ATTAGATTCTTGTAAGGAGCAGG - Intronic
1001356296 5:171026961-171026983 ATTAGATTCTCATAGGAGGACGG + Intronic
1001842999 5:174895430-174895452 ATTAGATTCTAAGAAGGTGCAGG + Intergenic
1001910810 5:175515953-175515975 ACTAGATTCTCATAAGGAGCGGG + Intronic
1003880738 6:10477409-10477431 ATGAGATGCACACAGGGAGACGG + Intergenic
1004148460 6:13091738-13091760 ATTAGATTCTCATAAGAAGCGGG + Intronic
1004659562 6:17698130-17698152 ATCTTATTCTCCCAGGGAGCAGG + Intronic
1004790794 6:19024029-19024051 ATTAGATTCTCATAAAGAGCAGG - Intergenic
1004837813 6:19547855-19547877 ATGAGATTACCACAGGAAGCTGG + Intergenic
1004875193 6:19944356-19944378 GTTAGATTCTCATAAGGAGCAGG + Intergenic
1005638952 6:27776546-27776568 ATTAGATTCTCATAAAGAGTGGG + Intergenic
1007141981 6:39585273-39585295 ATTAGATTCTCATAAGGAGCGGG + Intronic
1008222203 6:48868691-48868713 ATCAGATTCCAACAGAGAGCTGG - Intergenic
1008427823 6:51379930-51379952 ACTATTTTCTCACAGGAAGCTGG - Intergenic
1010284029 6:74054266-74054288 ATTTGATCATCACAGGGACCTGG - Intergenic
1012741280 6:103018947-103018969 ATTAGAATATTACAGGGAGGCGG - Intergenic
1013227082 6:108127580-108127602 ATTAGATTCTCATAAGGAGCGGG + Intronic
1013355928 6:109346018-109346040 GCTAGATTCTCATAAGGAGCAGG - Intergenic
1013825482 6:114205775-114205797 ATTAGATTCTCATACAGAACAGG + Intronic
1014108925 6:117598566-117598588 ATTAGACTCTCACAAGAAGCTGG + Intronic
1014118555 6:117695469-117695491 ATTAGGGTCTCATAGGGTGCAGG - Intronic
1014474672 6:121857848-121857870 GTTAGATTCTCATAAGAAGCAGG - Intergenic
1015593472 6:134844084-134844106 ATTAGATTCCTATAAGGAGCAGG + Intergenic
1015760085 6:136649291-136649313 ATTAGAGTCACCCAGGGAGCTGG - Intronic
1016462847 6:144296322-144296344 ATTAGATTCTCATAAGGAGCAGG - Intronic
1019155283 6:170034358-170034380 AATACAGTCTCACTGGGAGCTGG + Intergenic
1022159002 7:27690179-27690201 ATTAGGATCTCATATGGAGCAGG - Intergenic
1022963924 7:35455473-35455495 ATCAGATTCTCAAAAGGACCTGG - Intergenic
1023327003 7:39071217-39071239 ATTAGATTCTCACAAGGAATGGG + Intronic
1023618956 7:42049989-42050011 ATTATATTCTGACAGGGTGATGG - Intronic
1024393501 7:48840976-48840998 ATTAGATTCTCATAAGGCTCAGG - Intergenic
1024758040 7:52559836-52559858 ATTTGATTATTACAGGGAACAGG - Intergenic
1025625573 7:63218371-63218393 ATTAGACTCTCATAAGGAGTAGG + Intergenic
1025656533 7:63524758-63524780 ATTAGACTCTCATAAGGAGTAGG - Intergenic
1026142075 7:67714784-67714806 ATTGGATTCTCACAGAAACCTGG - Intergenic
1026260130 7:68747856-68747878 ATTAGATTTTCATAAGGAGCCGG + Intergenic
1027426654 7:78068171-78068193 ATTACATGCTCATAAGGAGCAGG + Intronic
1029616167 7:101659249-101659271 AGCATATTTTCACAGGGAGCAGG + Intergenic
1031120153 7:117713087-117713109 ATTAGATTCTCGCAAGGACTGGG - Intronic
1031749491 7:125554503-125554525 ATTATATCCTCACATGGAGAAGG - Intergenic
1032073413 7:128823969-128823991 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1032293537 7:130613178-130613200 ATTAGATTCTCATATGAGGCCGG + Intronic
1032795591 7:135273644-135273666 ATTAGATTCTCATAAGGAGCAGG + Intergenic
1033397147 7:140986048-140986070 ATCAGATTCTCACAAAGAGCAGG - Intergenic
1033535436 7:142307970-142307992 ATAAGAACATCACAGGGAGCAGG + Intergenic
1033607141 7:142936000-142936022 ATTATGTTCTCACTGGGAGTGGG + Intergenic
1034319635 7:150168377-150168399 ATTAGATTCTCATAAGGATCAGG - Intergenic
1034773121 7:153798842-153798864 ATTAGATTCTCATAAGGATCAGG + Intergenic
1035015040 7:155758419-155758441 ATTAGAGTCTTATAAGGAGCTGG + Intronic
1037371941 8:18189559-18189581 ATTAGAATCTCAAGGGGAGTGGG + Intronic
1037620030 8:20555562-20555584 ATTATAGTTTCACAGGGAGTGGG + Intergenic
1040907475 8:52483512-52483534 ATTAGATTCTCATAAGAAGCAGG + Intergenic
1041436665 8:57849199-57849221 ATTACATTCTCATAGGGGGCTGG - Intergenic
1044192265 8:89333026-89333048 ACTAGATTATGACAGAGAGCAGG + Intergenic
1046013120 8:108574253-108574275 ATTAGATTCTCATAGGAACGTGG - Intergenic
1046870655 8:119202531-119202553 ATTAGAGTCTCAGAAGGAGAAGG - Intronic
1047292157 8:123540630-123540652 ATCAGACTCTCAGAGGGACCAGG + Intronic
1048779413 8:137985292-137985314 ATTAGATTCTCATAAGGAGTGGG - Intergenic
1048802128 8:138203895-138203917 ATTAGATTCTCATAAGGAATGGG + Intronic
1050057044 9:1666571-1666593 ATTAGATTCTCACAGGGAGCAGG - Intergenic
1050712061 9:8476230-8476252 ATTAGATTCTCATAAAGAGCCGG + Intronic
1050871151 9:10571770-10571792 ACTAGATTCTCATAAGGAACAGG + Intronic
1055374664 9:75636041-75636063 ATTACATTCTCATAAGGAGCAGG - Intergenic
1056751660 9:89356225-89356247 GTTAGATTCTCATAAGGAGCAGG - Intronic
1058646117 9:107132856-107132878 ATAAGATTCTCATAATGAGCAGG - Intergenic
1059223090 9:112644313-112644335 AGGAGATGCTCAGAGGGAGCAGG + Intronic
1059461179 9:114431274-114431296 ATTTGATTCTCACAGCTACCTGG - Intronic
1060333941 9:122704086-122704108 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1060344694 9:122805982-122806004 ATTAGATTCTCATAAGGAGCAGG - Intronic
1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG + Intergenic
1061889607 9:133610945-133610967 ACAAGATACTCACAGGGGGCAGG - Intergenic
1062719909 9:138034735-138034757 ATAAGATTCTAACAGGTAGAAGG - Intronic
1203491274 Un_GL000224v1:107735-107757 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1203503898 Un_KI270741v1:49605-49627 ATTAGATTCTCATAAGGAGCAGG - Intergenic
1203547030 Un_KI270743v1:135796-135818 ATTAGATTATGACAGGGAGTGGG - Intergenic
1203653392 Un_KI270752v1:260-282 ATTAAATTATCACAGGGTGGTGG - Intergenic
1186079903 X:5919697-5919719 ATTAGATTCTCATAAGGAGCAGG - Intronic
1186085960 X:5991162-5991184 ATTTGAATCTCACAGGGAGAAGG - Intronic
1186235105 X:7499332-7499354 ATTAGTTTCTCACAGAAACCTGG - Intergenic
1189246089 X:39564643-39564665 ATTAGATTCTCAGTGGAAGTTGG - Intergenic
1189641939 X:43082075-43082097 ATTAGATTCTAATAAAGAGCAGG - Intergenic
1189839402 X:45057373-45057395 ATTAGATGTTCACAGGGTGGGGG - Intronic
1195814881 X:108873824-108873846 ATTACATTATCACAAGGAGGAGG - Intergenic
1195953814 X:110307331-110307353 ATTACATTCTCACAGATAACTGG - Intronic
1197280243 X:124527238-124527260 ATTAGATACTCACATAGAGAAGG - Intronic
1199120228 X:144043822-144043844 ATTAGAATGTCATAGGAAGCCGG - Intergenic