ID: 1072990889

View in Genome Browser
Species Human (GRCh38)
Location 10:100192182-100192204
Sequence CAAGCAACTACACTTCAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072990888_1072990889 21 Left 1072990888 10:100192138-100192160 CCTTCTAGAAAATACATTGAAAA 0: 1
1: 0
2: 6
3: 63
4: 696
Right 1072990889 10:100192182-100192204 CAAGCAACTACACTTCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072990889 Original CRISPR CAAGCAACTACACTTCAAAT TGG Intronic
No off target data available for this crispr