ID: 1072991915

View in Genome Browser
Species Human (GRCh38)
Location 10:100204013-100204035
Sequence CCTCACATGCAGAAGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072991910_1072991915 3 Left 1072991910 10:100203987-100204009 CCTAGATGACCATCTTCTTGCTC 0: 1
1: 0
2: 3
3: 20
4: 184
Right 1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG No data
1072991911_1072991915 -6 Left 1072991911 10:100203996-100204018 CCATCTTCTTGCTCTGTCCTCAC 0: 1
1: 31
2: 280
3: 732
4: 1896
Right 1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG No data
1072991909_1072991915 17 Left 1072991909 10:100203973-100203995 CCTGCTTTCTGGTTCCTAGATGA 0: 1
1: 2
2: 78
3: 282
4: 729
Right 1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072991915 Original CRISPR CCTCACATGCAGAAGGGATG AGG Intronic
No off target data available for this crispr