ID: 1072994280

View in Genome Browser
Species Human (GRCh38)
Location 10:100229499-100229521
Sequence CCGCGCCCGGCCGCAGCCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 0, 2: 9, 3: 85, 4: 606}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072994265_1072994280 8 Left 1072994265 10:100229468-100229490 CCCAGCCGCTCCCGCATCTCCCA 0: 1
1: 0
2: 2
3: 14
4: 239
Right 1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG 0: 1
1: 0
2: 9
3: 85
4: 606
1072994266_1072994280 7 Left 1072994266 10:100229469-100229491 CCAGCCGCTCCCGCATCTCCCAG 0: 1
1: 0
2: 3
3: 29
4: 375
Right 1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG 0: 1
1: 0
2: 9
3: 85
4: 606
1072994263_1072994280 17 Left 1072994263 10:100229459-100229481 CCGCCGGTGCCCAGCCGCTCCCG 0: 1
1: 0
2: 3
3: 22
4: 220
Right 1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG 0: 1
1: 0
2: 9
3: 85
4: 606
1072994269_1072994280 3 Left 1072994269 10:100229473-100229495 CCGCTCCCGCATCTCCCAGGGCC 0: 1
1: 0
2: 3
3: 49
4: 506
Right 1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG 0: 1
1: 0
2: 9
3: 85
4: 606
1072994264_1072994280 14 Left 1072994264 10:100229462-100229484 CCGGTGCCCAGCCGCTCCCGCAT 0: 1
1: 0
2: 0
3: 15
4: 281
Right 1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG 0: 1
1: 0
2: 9
3: 85
4: 606
1072994262_1072994280 23 Left 1072994262 10:100229453-100229475 CCGAAGCCGCCGGTGCCCAGCCG 0: 1
1: 1
2: 0
3: 7
4: 87
Right 1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG 0: 1
1: 0
2: 9
3: 85
4: 606
1072994261_1072994280 24 Left 1072994261 10:100229452-100229474 CCCGAAGCCGCCGGTGCCCAGCC 0: 1
1: 1
2: 0
3: 12
4: 196
Right 1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG 0: 1
1: 0
2: 9
3: 85
4: 606
1072994271_1072994280 -3 Left 1072994271 10:100229479-100229501 CCGCATCTCCCAGGGCCCGCCCG 0: 1
1: 0
2: 0
3: 27
4: 299
Right 1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG 0: 1
1: 0
2: 9
3: 85
4: 606
1072994270_1072994280 -2 Left 1072994270 10:100229478-100229500 CCCGCATCTCCCAGGGCCCGCCC 0: 1
1: 0
2: 3
3: 43
4: 488
Right 1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG 0: 1
1: 0
2: 9
3: 85
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072994280 Original CRISPR CCGCGCCCGGCCGCAGCCCC GGG Exonic
900162782 1:1232251-1232273 CCGCGCCGGGCCGGCGGCCCAGG - Exonic
900165547 1:1243022-1243044 CCGCTCCAGGCGGCAGCCCCCGG - Intronic
900180132 1:1307659-1307681 CCGGGCCGGGCCGCGGCCGCCGG - Intronic
900189980 1:1349217-1349239 CAGGCCCCGGCCGCCGCCCCCGG + Intronic
900373730 1:2343971-2343993 CTGCCCCTGGCCCCAGCCCCAGG - Intronic
900414007 1:2526777-2526799 GCCCGCCCGCCCGCAGCCCCGGG - Intergenic
900583908 1:3423338-3423360 CTGGGCCCGGCAGCAGCACCCGG + Intronic
901729997 1:11272905-11272927 CACCGCCCGGCCCCAGCTCCTGG + Intergenic
901738274 1:11325987-11326009 CTGCACCCAGCCCCAGCCCCGGG - Intergenic
902286123 1:15409814-15409836 GCGCGCCCCGCCCCCGCCCCCGG - Intergenic
902897066 1:19485974-19485996 CCGCGCTCGGCGGCAGTTCCGGG - Intergenic
903178266 1:21593146-21593168 CAGAGGCCGGCCTCAGCCCCAGG + Intergenic
903193579 1:21669471-21669493 CCCCGCCCCGCCGCAGGTCCTGG + Intergenic
903349798 1:22710877-22710899 CCGCGCCTTGCCGCCCCCCCTGG + Intronic
903349896 1:22711143-22711165 CTGCGCCCGGCGCCGGCCCCCGG - Intronic
903497395 1:23778722-23778744 CCCCGCCCGCCCCAAGCCCCAGG - Intronic
903557011 1:24201388-24201410 CGGCGCCCGGCCCAAGCCCATGG - Intergenic
904009851 1:27383261-27383283 CCGATCCCGGCCACCGCCCCCGG - Exonic
904236687 1:29121581-29121603 CCGCACCGGGCCGGGGCCCCAGG - Exonic
904618652 1:31763046-31763068 ACGCACCCTCCCGCAGCCCCAGG - Intronic
904782985 1:32964526-32964548 CCGCGCCCGGGCCAAGCCGCAGG - Exonic
905442780 1:38005561-38005583 CCCCGCCCGGACCCCGCCCCCGG + Intronic
905626099 1:39491514-39491536 CCGCGCCCGCTAGGAGCCCCGGG - Intergenic
905670821 1:39788970-39788992 GCGACACCGGCCGCAGCCCCGGG - Intergenic
905734565 1:40316649-40316671 ACCCGCGCGCCCGCAGCCCCCGG + Intronic
906345324 1:45011026-45011048 CGGCGCCCACACGCAGCCCCAGG + Exonic
906719746 1:47996717-47996739 TCGCGCCCGCCCGCAGCCCCCGG - Exonic
907442881 1:54489438-54489460 CCGCTGCCGGCCCCAGCCCGGGG - Intergenic
907477564 1:54715761-54715783 CCACGCCCGGCCACGCCCCCAGG + Intronic
907516620 1:54997148-54997170 CCGAGCCCAGCCGCTGACCCCGG + Intergenic
910237130 1:85048047-85048069 CCACCCCCGCCCGGAGCCCCTGG - Intronic
910728238 1:90360884-90360906 CTGCTCCCGGCTGAAGCCCCAGG + Intergenic
912798628 1:112707234-112707256 CCGCGCAGGGCCGCAGCCACCGG + Intronic
912938533 1:114024699-114024721 CCGCGCCCGGCCCCGAACCCTGG - Intergenic
913191747 1:116418759-116418781 GCGCGCCCGGCTGCGGCCCCAGG + Intergenic
914753142 1:150549299-150549321 CCGCGCCCCTCGGCGGCCCCGGG - Intergenic
915113165 1:153577699-153577721 CCACGCCCGGCCACACCCCTCGG + Intergenic
915117177 1:153608410-153608432 CCAGGCCCTGCCCCAGCCCCAGG + Intronic
915213350 1:154325630-154325652 GCGCCCCCCGCCCCAGCCCCCGG + Intronic
915932749 1:160070171-160070193 CCGACCCCGGCCCCGGCCCCCGG - Exonic
916076424 1:161202430-161202452 CAGCCCCAGGCCGCAGCACCTGG - Exonic
916548295 1:165827482-165827504 CCGGGCCCCGCCGCCGCCCGAGG - Intronic
918388868 1:184037462-184037484 CCGCGGCAAGCCGCATCCCCCGG - Exonic
919513124 1:198491010-198491032 CCCCTCCCGGCCTCAGCCCCAGG - Intergenic
919826482 1:201506970-201506992 GCCAGCCCCGCCGCAGCCCCGGG - Intronic
919916928 1:202144625-202144647 CCGCTCCGGGCCGCAGCGCGAGG - Exonic
920095373 1:203483266-203483288 CTGCGCCCGGGCCCAGTCCCGGG - Exonic
920095375 1:203483273-203483295 CTGGGCCCGGGCGCAGACCCAGG + Exonic
920288512 1:204899387-204899409 CAGCTGCCGGCCTCAGCCCCAGG - Intronic
920528498 1:206685304-206685326 CCCTGCCCTGCCGCACCCCCCGG + Exonic
921029707 1:211326773-211326795 CCGCGCCCCGGCCCCGCCCCAGG + Intronic
921472721 1:215567713-215567735 CCGCTGCCGGCCGCCGCCGCGGG - Exonic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922925480 1:229343330-229343352 TCGCCCCCGGCCGCAGCCTGGGG - Intergenic
923631004 1:235649633-235649655 GGGCGCCCGGCCGGAGCCCCGGG - Intronic
1063418203 10:5890184-5890206 CTCCGCCCCGCCGCAGCCCCGGG - Intronic
1063929795 10:11017870-11017892 CCGCCCCCGCCCGCCGCACCTGG + Intronic
1064230759 10:13528373-13528395 GCGCGCCCTCCCGGAGCCCCCGG - Intronic
1064354414 10:14604352-14604374 GCGGGCCGGGCCGCCGCCCCCGG - Intronic
1065024204 10:21526066-21526088 CCGCCCCCGCCGCCAGCCCCGGG + Intergenic
1065590981 10:27260462-27260484 CCGCGCCCGGCCTCACCCTGAGG + Intergenic
1066080905 10:31929200-31929222 CCACGCCCGGCCGCAGCTCCAGG - Intergenic
1066402605 10:35090349-35090371 CCCCGGCCGGCCGCCGCCACCGG + Exonic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1067941323 10:50659475-50659497 CCGCGTCCAGCCCCAGGCCCTGG - Intergenic
1069639135 10:69943776-69943798 CAGCCCCCGGCCCCTGCCCCGGG + Intronic
1069709269 10:70478640-70478662 CTCAGCCCAGCCGCAGCCCCCGG - Intergenic
1070566132 10:77605141-77605163 CCGCGCCCAGCCGCAGCCCAGGG + Intronic
1070800907 10:79243787-79243809 CCGCGCCCGGAGGGAGCCCAGGG - Intronic
1071538208 10:86454508-86454530 CGGCGCCCGCCTGCAGTCCCAGG - Intronic
1072926308 10:99620264-99620286 CAGGGCCCGGGCGGAGCCCCGGG - Exonic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1073097302 10:100987618-100987640 CCGCGCCGGCCCCCAGCCCCAGG - Intronic
1073121188 10:101123401-101123423 CCAGGGCCGCCCGCAGCCCCAGG + Intronic
1073365205 10:102934569-102934591 CCGCGCCCAGCCTGAGCCACCGG + Intronic
1075409912 10:122219745-122219767 CCACGCCCGGCCCCAACCTCAGG - Intronic
1075845898 10:125544814-125544836 CCACGCCAGTCCGCAGCCACAGG + Intergenic
1076052377 10:127346106-127346128 CCGAGCCCAGCCACAGCTCCTGG + Intronic
1076809544 10:132879482-132879504 CGGCGCCCGGCGACAGCACCAGG + Exonic
1076878800 10:133230266-133230288 GCGCGCCGCGCCCCAGCCCCGGG + Exonic
1076879070 10:133231126-133231148 GCGCGCCCGTCCGCGGCCCCGGG + Exonic
1076905086 10:133357532-133357554 CCGGACCCGGCCGCCTCCCCAGG + Intronic
1076919949 10:133446209-133446231 TCGCGCCCGGAAGCTGCCCCGGG - Intergenic
1077008404 11:369609-369631 CCGCCCTCGGCCGCGGGCCCGGG - Intergenic
1077021057 11:417337-417359 CCCCGCCCGGCGCGAGCCCCAGG - Intronic
1077052905 11:575848-575870 CCGCGCGCGGCGGGAGCACCTGG - Intergenic
1077124131 11:925079-925101 CCGCCCCCGGCCGCTGTCACTGG + Intronic
1077413649 11:2414684-2414706 GCGGGCCCGGCCCCAGCCGCCGG + Intronic
1077491445 11:2862709-2862731 GCACGCCCGGCCGCGGCTCCCGG - Intergenic
1077880776 11:6347969-6347991 CCGCGCCTGGCCGCAGCTACTGG - Intergenic
1078334175 11:10450889-10450911 CCGCGCCCCGCAGCAGGCGCGGG - Exonic
1078986658 11:16605061-16605083 CCGAGCCCGGCCGCTCCCGCGGG - Intronic
1079361997 11:19777273-19777295 CCGCGCGCAGCAGCGGCCCCGGG + Intronic
1079611031 11:22432745-22432767 CCGCCTCCCGCCGCAGACCCTGG - Intergenic
1080036679 11:27719129-27719151 CCGCCCCCGCCTGCACCCCCGGG - Intronic
1080283602 11:30585393-30585415 CTGCGCCCCGCGGCCGCCCCCGG - Intronic
1080540353 11:33258176-33258198 CCGCGCCTGGCCGGGGCCCGGGG + Intronic
1081531601 11:43964152-43964174 CCGCGCCTGGCCACAGCCCTAGG - Intergenic
1081636904 11:44727367-44727389 CCGCGTCCAGCAGCACCCCCGGG - Intronic
1081686427 11:45046432-45046454 CCGCGCCCGTCCTCACTCCCAGG - Intergenic
1081696959 11:45119335-45119357 CCGCGCCCGGCCGCCTTACCAGG - Intronic
1081700029 11:45146973-45146995 CCGCCCCCAGCCGCCGCTCCCGG - Intronic
1081831604 11:46120387-46120409 CCGCCCCCGCCCGCAGCCCCCGG + Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1082986156 11:59172567-59172589 CCGCGCAGCGCCGCAGCCCCGGG + Exonic
1083160774 11:60852876-60852898 ACACGAGCGGCCGCAGCCCCGGG + Exonic
1083472890 11:62896088-62896110 CCGCGCCCAGCTGGAGCACCTGG + Intergenic
1083638605 11:64133468-64133490 CTTCACACGGCCGCAGCCCCGGG - Intronic
1083648458 11:64186418-64186440 CCGCTCCCGCCCGCCGCCCGCGG - Intronic
1083684750 11:64369463-64369485 CCCCGCCCCGCAGCAGCTCCAGG - Exonic
1083777957 11:64903407-64903429 CCGGCCCCGGCCCCAGCACCTGG + Intronic
1083922134 11:65786821-65786843 CCCCGCCCGGCCGCCCCGCCCGG + Intergenic
1083927342 11:65816101-65816123 CCGCGCCCGGCCTCAGGCTCCGG + Intergenic
1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG + Intergenic
1083997225 11:66278429-66278451 CCGCGCCGGGCGGCGGCCCGGGG - Exonic
1084010883 11:66347712-66347734 CCGCCACCGCCCCCAGCCCCCGG + Intergenic
1084336582 11:68461116-68461138 CCTCGCCCGCCCGCCGCGCCAGG - Intronic
1084361208 11:68669702-68669724 CCCAGCCCAGCCTCAGCCCCAGG - Intergenic
1084385805 11:68841979-68842001 CCCCGCCCCGCCGAGGCCCCGGG - Intronic
1084562294 11:69911747-69911769 CCGCGCCCAGCCCCAGGTCCGGG - Intergenic
1084564381 11:69920925-69920947 CCGCGGCCTGCAGCAGCCACAGG + Intergenic
1084621105 11:70270779-70270801 CCGCCCCACGCCGCGGCCCCGGG - Exonic
1084797510 11:71518659-71518681 CCGCGCCAGCCTGAAGCCCCCGG + Intronic
1084943200 11:72625309-72625331 CCGGGCCTCGCCCCAGCCCCAGG + Intronic
1084946781 11:72642769-72642791 CGGGGCCCGGCCAGAGCCCCAGG + Intronic
1085396067 11:76207787-76207809 CCCCGCCCGCCCGCAGCCCGCGG + Intronic
1085519529 11:77129973-77129995 CCGGGCCCGGGCCCAGGCCCAGG + Intronic
1085666200 11:78417581-78417603 CCCCGCCCCTCCGCAGGCCCCGG + Intronic
1087014668 11:93543393-93543415 GCGCGCCAGACCGCAGCGCCAGG + Exonic
1088755094 11:112879011-112879033 CCGGGCCCTGCCGCAGCCAGAGG - Intergenic
1088889734 11:114035138-114035160 CCGCGCCAGCCAGCAGCCCTGGG + Intergenic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1089694980 11:120211255-120211277 CCGCGGACGGCAGCGGCCCCCGG + Exonic
1090078615 11:123595366-123595388 CCGCCCCTGCCCCCAGCCCCTGG + Intronic
1090326170 11:125887976-125887998 GCGCGGCGGGCCGCAGCCCCTGG + Intronic
1091262523 11:134245646-134245668 CCGCCCCCGCCCCCAGCCGCTGG - Exonic
1091640152 12:2230149-2230171 CGGCTCCAGGTCGCAGCCCCGGG - Intronic
1091718334 12:2795312-2795334 CCGTGCCCGGCCGCGGGCTCCGG - Intronic
1092196979 12:6555600-6555622 GGGCGCCCAGCTGCAGCCCCAGG + Exonic
1092383603 12:8018763-8018785 CCGGCCCCGCCCGCAGCCGCTGG + Intergenic
1094367134 12:29695593-29695615 CCGCGCCAGGCCACATCCACAGG + Intronic
1094635862 12:32226886-32226908 CCCCGCCAGGCTCCAGCCCCAGG - Intronic
1096183644 12:49564843-49564865 CCCAGCCCAGCCCCAGCCCCTGG - Exonic
1096647710 12:53047514-53047536 CCGCGGCCAGCCAGAGCCCCCGG - Intronic
1096796742 12:54082573-54082595 CCGGCCCCGGCCCCGGCCCCCGG - Intergenic
1097192185 12:57224919-57224941 CCGCGGCGGGGCGCAGCCCCAGG - Exonic
1097196174 12:57243517-57243539 CCGCCCCCCGCCCCAGTCCCTGG + Exonic
1097267745 12:57755600-57755622 CCGGGCCGAGCCGCAACCCCGGG + Exonic
1098288517 12:68933218-68933240 GCGCGCCCGGGCCCCGCCCCCGG + Intronic
1101482155 12:105108146-105108168 GCGCGCCCCGCCCAAGCCCCGGG - Intronic
1101910483 12:108857389-108857411 CCGCGCCCGGCCTGGGCCGCCGG - Intronic
1102808730 12:115805160-115805182 CCGTCCCCGGCCACATCCCCAGG - Intergenic
1103071879 12:117951196-117951218 CCGCGCCCGGCGGCAACCAGTGG + Intronic
1103527584 12:121578567-121578589 CCGCGCCCACCACCAGCCCCAGG - Intronic
1103764334 12:123270703-123270725 CCGGCTGCGGCCGCAGCCCCAGG + Intronic
1103764404 12:123270932-123270954 ACGCTCCCGGCCGAGGCCCCCGG + Intronic
1103764615 12:123271491-123271513 GCGCGCCCGGCCCCGGCCCGGGG - Intronic
1103779359 12:123389021-123389043 CCGCGCACCGCGGCAGCCCCGGG - Intronic
1103991333 12:124801279-124801301 CCGCCCCCTCCCCCAGCCCCTGG - Intronic
1104049615 12:125186697-125186719 CGGCGCCCGGGCGTAGCCGCCGG + Intergenic
1104602449 12:130162667-130162689 TCGCGCCGGGCCGCTGCGCCGGG + Exonic
1104859358 12:131916547-131916569 CCTCGCCTGGCCGCAGGCCAGGG - Exonic
1105013954 12:132774560-132774582 CCCCGTCCTGCCGCAGACCCAGG - Intronic
1105217448 13:18297507-18297529 CCGCGCACCGCGGCAGCCCCGGG - Intergenic
1105512150 13:21060675-21060697 CCGCGCCGCCCCTCAGCCCCCGG - Intronic
1105557247 13:21459018-21459040 CCGCGCCCCGCCGCAGTCCCCGG + Intronic
1105756174 13:23466442-23466464 CCGCGCCCGGAGGAAGCCCACGG - Intergenic
1106036900 13:26051705-26051727 GCGCCCCCAGCCGCAGTCCCGGG + Intergenic
1106422593 13:29595818-29595840 CGGTCCCCGGCCGCAGCCTCTGG - Intergenic
1107654152 13:42574459-42574481 CCTGGCCCAGCCCCAGCCCCAGG - Exonic
1108368316 13:49740815-49740837 CCACCCCTGGCCCCAGCCCCTGG + Intronic
1108616785 13:52140968-52140990 CCACGCCCGGCCACCGCGCCCGG + Intronic
1111424100 13:88057113-88057135 GCGCCCCCATCCGCAGCCCCTGG + Intergenic
1111822287 13:93228148-93228170 CCGCCCCCGGCCCGAGCGCCGGG - Intronic
1112051108 13:95644403-95644425 CCCCGCCCGCCTGCAGCGCCCGG - Intronic
1113082828 13:106535550-106535572 CCGCGCGCGTCCGGAGCCCGCGG - Intergenic
1113494045 13:110713977-110713999 CCGAGCCCGTCCGCCGCCTCCGG - Intronic
1113737868 13:112690663-112690685 CAGCGCGGGGCCCCAGCCCCGGG + Intronic
1113768299 13:112894246-112894268 CCCCGCCCCGCCCCCGCCCCCGG + Intergenic
1113805920 13:113110007-113110029 CAGCCCCCCGCCGCAGCTCCTGG - Intronic
1113943352 13:114029854-114029876 CCTCGCTCAGCCGCAGCTCCAGG + Exonic
1113985691 13:114314263-114314285 GCGCGCCCGGGCGCGGCTCCGGG - Intergenic
1114267985 14:21083864-21083886 CCGAGCCCTGCAGCAGCCTCTGG + Exonic
1114422796 14:22598534-22598556 ACGCGCTCGCCCGCAGCCCGGGG + Intronic
1114623548 14:24114074-24114096 CCGCCCCCGGCCGCGGGTCCAGG - Intronic
1115509333 14:34124440-34124462 CCAGGCCTGGCCGCAGCCACAGG - Intronic
1117092847 14:52267925-52267947 CCGAGCGCGCCAGCAGCCCCAGG - Exonic
1119219147 14:72892750-72892772 CCCCGCCCGGACGAAGCCGCAGG - Intronic
1119652790 14:76395371-76395393 ACACGCCCCGCTGCAGCCCCCGG - Intronic
1119672750 14:76531889-76531911 CCTCGCCCAGCAGCAGGCCCGGG + Intergenic
1121050376 14:90816091-90816113 CCGCGCCCGGCCGCGCCTCGGGG + Intronic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122155569 14:99748222-99748244 CAGCCCCTGCCCGCAGCCCCAGG + Intronic
1122271197 14:100569062-100569084 CCGAGCCTGGCCGAGGCCCCGGG - Intronic
1122582222 14:102777823-102777845 CCGCGCCCCGCCGTCGCCGCTGG - Intronic
1122960975 14:105093518-105093540 CCGCCCCCGGCCCGCGCCCCGGG + Intergenic
1123004516 14:105314868-105314890 CGCGGCCCGGCCGCAGCCCCAGG + Exonic
1123012436 14:105355959-105355981 CCACTCACGCCCGCAGCCCCTGG - Intronic
1123034594 14:105466749-105466771 CAGCGCCCGCCCGCGGCTCCAGG - Intronic
1123048725 14:105530629-105530651 CAGCCCCAGGTCGCAGCCCCAGG + Intergenic
1123056707 14:105574263-105574285 TCCCGACCGGCCGCAGCCCTTGG - Intergenic
1123081502 14:105697522-105697544 TCCCGACCGGCCGCAGCCCTCGG + Intergenic
1123119371 14:105909728-105909750 CCCCGACCCGCCGGAGCCCCCGG + Intergenic
1123787462 15:23687395-23687417 CCCCGCCCGCCCCCAGCCGCTGG - Intergenic
1124129392 15:26971211-26971233 CCGCGCCCGCTCGCGGCTCCAGG + Intergenic
1124351864 15:28961630-28961652 ACCCGCCCGGCCGCTCCCCCGGG - Intronic
1124469302 15:29968899-29968921 CCACGCACGGCCGCAGCTGCGGG - Intergenic
1126738150 15:51751911-51751933 TCCCGCCCGGGCGCAGCGCCTGG - Intronic
1126777459 15:52112246-52112268 CCGCGCCTGGCTGCAGGCTCAGG - Exonic
1126777605 15:52112802-52112824 CCGTGCCCCGCCCCGGCCCCCGG + Intergenic
1126850171 15:52791636-52791658 CAGCGCCGAGCCTCAGCCCCAGG + Intergenic
1127293679 15:57591880-57591902 CCGCCCCCGGCCCCACCCCCGGG + Intergenic
1127931656 15:63601041-63601063 CGCCGCCCCGCCGCTGCCCCCGG + Intronic
1128315145 15:66655219-66655241 CCGAGCCCGCCCGCAGCGCCTGG + Intronic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1129162114 15:73752851-73752873 CCCAGCCCGGCCGGGGCCCCCGG - Intergenic
1129725960 15:77901824-77901846 CAGAGCCGGGCTGCAGCCCCTGG - Intergenic
1131526746 15:93158773-93158795 CCCCGCCCTGCCCCAGCCCTGGG - Intergenic
1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG + Intergenic
1131969270 15:97875750-97875772 CCGCGCGCAGCCGCGGCTCCCGG - Intergenic
1132056119 15:98650687-98650709 CCCCGCGCCGCCGCAGACCCTGG - Intronic
1132163631 15:99565323-99565345 TCGCGCCCCGCCCCCGCCCCGGG + Intergenic
1132251977 15:100341316-100341338 CCGCCGCTGCCCGCAGCCCCCGG - Exonic
1132365081 15:101251430-101251452 CCGCGCGCGGCCGGCGCGCCTGG - Exonic
1132398259 15:101489622-101489644 CGGGCCCCGGCCGCCGCCCCGGG - Exonic
1132454373 16:14472-14494 CCGGGCCCGTCACCAGCCCCAGG + Exonic
1132641426 16:980271-980293 CCGCCCCCGTCCGCAGACCCCGG - Intronic
1132703735 16:1232311-1232333 CCCAGCCCTGCAGCAGCCCCAGG - Intergenic
1132704775 16:1239050-1239072 CCCAGCCCTGCAGCAGCCCCAGG + Intergenic
1132707783 16:1254084-1254106 CCCAGCCCTGCAGCAGCCCCAGG + Intergenic
1132728578 16:1349546-1349568 CCGCGCTCGGCGCCAGGCCCTGG + Exonic
1132763113 16:1520574-1520596 CCTCTCCCGGCCCCAGCCCGCGG - Intronic
1132779351 16:1614311-1614333 CCGGCCCCGGCCCCGGCCCCGGG - Intronic
1132865105 16:2089416-2089438 CTGTGCCCGGCCCCACCCCCTGG - Exonic
1132869373 16:2108903-2108925 CCGCCACCAGCCCCAGCCCCCGG - Exonic
1133008014 16:2895334-2895356 CCGCGCCTGGCCACACCCACTGG - Intronic
1133259424 16:4538559-4538581 CCGCCCCCGCCCGCGGCGCCTGG - Intronic
1133286594 16:4693630-4693652 CCGCGGGCGGCCGCGCCCCCGGG - Intergenic
1134134181 16:11668652-11668674 CCTCCCCCGCCCGCAGACCCCGG - Intronic
1134163832 16:11915172-11915194 CCCCGCCCGGCCACCGCCGCGGG + Intronic
1134419403 16:14071589-14071611 TCGCGCCCGGGCGCGACCCCGGG + Intronic
1134567710 16:15265693-15265715 CCGCGCCAGTCCACAGTCCCAGG + Intergenic
1134718039 16:16366695-16366717 CCGCCACCAGCCCCAGCCCCCGG + Intergenic
1134956713 16:18385464-18385486 CCGCCACCAGCCCCAGCCCCCGG - Intergenic
1136220181 16:28823440-28823462 CCGCTCCCGGCAGCGGCCACAGG - Exonic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1136458428 16:30395422-30395444 CCGCCCCCGGTGGCCGCCCCCGG + Exonic
1136519527 16:30786886-30786908 CCCACCCCGGCCACAGCCCCGGG + Intronic
1136561080 16:31039661-31039683 CCAGGCCCGGCCACTGCCCCAGG + Intronic
1137300254 16:47142989-47143011 CGGCGCCCGCGCGCCGCCCCCGG + Intronic
1139466041 16:67154732-67154754 CCGCGCCACGCTGCAGCGCCTGG - Exonic
1139489594 16:67279299-67279321 CCCCGCCCCGCCGCACCCCCGGG - Exonic
1139761508 16:69187628-69187650 CGTCGCCCAGCCGCAGCGCCCGG - Exonic
1141576482 16:84967122-84967144 CCGCGCCCGGCCTAACCCCTGGG - Intergenic
1141620893 16:85235995-85236017 CCAGGCCCAGCCTCAGCCCCAGG - Intergenic
1141620901 16:85236013-85236035 CCAGCCCCAGCCGCAGCCCCAGG - Intergenic
1141699796 16:85637175-85637197 CCACGCCCTCCCCCAGCCCCCGG + Intronic
1141896069 16:86959442-86959464 CCGCGCTGGGACGCAGCCCTCGG + Intergenic
1142130059 16:88428255-88428277 GCAGGCCCGGCGGCAGCCCCAGG + Exonic
1142173190 16:88633546-88633568 CAGCCCCCGGCCACAGCCCTAGG + Intergenic
1142174567 16:88639238-88639260 CCTCCTCCGGCCGCAGCACCGGG - Exonic
1142209160 16:88799743-88799765 CTGCCCCCGGCTGGAGCCCCAGG + Intergenic
1142209886 16:88803982-88804004 GCCCGCCCGCCCGCCGCCCCCGG + Exonic
1142222750 16:88863668-88863690 CCACTCCCTGCCCCAGCCCCAGG + Exonic
1142293022 16:89201362-89201384 CCGCGCCCTGCACCCGCCCCGGG - Intronic
1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG + Intronic
1142478772 17:205287-205309 CAGCGCCCGGCCCCACCCCGGGG - Intergenic
1143321191 17:6070337-6070359 CGGCGGCCGGCCGCTGTCCCCGG + Intronic
1143562673 17:7705025-7705047 CGCCGCCCCGCCTCAGCCCCCGG - Intergenic
1143635757 17:8162998-8163020 CCGCCCCCGCCCGCAGTGCCCGG - Intronic
1144854079 17:18258500-18258522 CCCGCCCCGGCCGCAGTCCCTGG + Intronic
1145273037 17:21414749-21414771 CCCCTTCCGGCCACAGCCCCTGG - Intronic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1145937918 17:28726058-28726080 CCCCGCCCTGCCGCTGCTCCTGG - Exonic
1146283572 17:31559945-31559967 CGGCGACCGGACCCAGCCCCGGG + Intergenic
1146492402 17:33292325-33292347 CCGCCTCAGCCCGCAGCCCCTGG + Exonic
1146492667 17:33293285-33293307 CCCCGCCCGCCCGGAGCCGCGGG - Intronic
1147168623 17:38605779-38605801 CCTCGCTCGGCCCCAGCCCCGGG + Exonic
1147183636 17:38702298-38702320 CCGCGCCGGCCCGCACCTCCCGG - Intergenic
1147393382 17:40122974-40122996 CCGGAGCCGGCTGCAGCCCCCGG + Intronic
1147653103 17:42072966-42072988 CCGCCCCCGGCCGCTACCTCTGG + Intergenic
1147742559 17:42677139-42677161 CCGCGCCCGGCGCCAGGCACAGG - Intergenic
1147743778 17:42683081-42683103 CAGAGCCCAGCCCCAGCCCCGGG - Intronic
1147793055 17:43025212-43025234 CCGCGCCGAGCCCCCGCCCCGGG - Intergenic
1147854065 17:43465319-43465341 CCGCACCCAGCCCCAGCACCAGG - Intergenic
1147890593 17:43713972-43713994 CCGCGCCCGCCCCCCGCGCCGGG - Intergenic
1147971396 17:44220382-44220404 CCGCGCCCACCCTCATCCCCCGG + Intronic
1148048749 17:44759156-44759178 CCGCTGGCAGCCGCAGCCCCCGG + Exonic
1148093047 17:45034157-45034179 CCGCCCCCCGCCCCAGGCCCTGG + Intronic
1148796475 17:50199684-50199706 CCACCCCCAGCCCCAGCCCCAGG + Intronic
1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG + Intergenic
1149470900 17:56914248-56914270 CCGGGCTCGGCCTTAGCCCCCGG + Intergenic
1149994632 17:61400133-61400155 CCGGCCCCGGCCCCGGCCCCCGG + Exonic
1150267770 17:63842299-63842321 CCGCGACCCGCCGCAGCCCGAGG + Intronic
1150423286 17:65056950-65056972 GCGCGCCCGGCCGCGGCTGCGGG - Intergenic
1150488775 17:65560900-65560922 CGGCTCGCGGCGGCAGCCCCGGG + Intronic
1150690917 17:67366357-67366379 CCGCGCCGTGACTCAGCCCCTGG + Intronic
1150699436 17:67434518-67434540 CCGCGCCCAGCCTGAGCTCCGGG - Intronic
1150763879 17:67987927-67987949 CCGCGCCCGGCCTCAATGCCCGG - Intergenic
1151818503 17:76483969-76483991 CCGCGCCCGGCCACAGCTGGGGG - Intronic
1151854464 17:76710996-76711018 CCGCGCCCCGTCGCCGCGCCCGG + Intronic
1152097467 17:78280223-78280245 CCACCCCTGGCCGCAGCCCCTGG - Intergenic
1152159983 17:78662027-78662049 CCGCGCCCGGCCCCAGCTGTAGG - Intergenic
1152175165 17:78782362-78782384 CTGCGCCCGCCCCCTGCCCCCGG + Intergenic
1152212441 17:79009617-79009639 CGGCGCCCTGCCCCAGCCACGGG - Intronic
1152245560 17:79183077-79183099 CCGCGCTCGGCCGCCGCGCAGGG + Intronic
1152245616 17:79183231-79183253 CCCCGCCCGGCCCCGGCCCCCGG - Intronic
1152352931 17:79793400-79793422 CCGTGCCCGGCCGGAGCCGCGGG + Exonic
1152357256 17:79813302-79813324 CCGCCCCCGCCCGCTCCCCCGGG + Intergenic
1152535763 17:80949586-80949608 CCGAGTGCGTCCGCAGCCCCGGG - Intronic
1152784907 17:82242492-82242514 CCCTGCCCGGCAGCAGGCCCAGG + Intronic
1152822223 17:82443199-82443221 CTGCGCCCGGCTGGAGCTCCCGG + Exonic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1153480623 18:5543479-5543501 CCGCGCTCGCCCCCAGCCCGAGG + Intronic
1153805492 18:8705935-8705957 CCGCGCCCGGCCGCCTCTCTCGG + Intronic
1153911171 18:9708034-9708056 CCCCGCCTGGCCGCAGGGCCCGG - Intergenic
1155221499 18:23689798-23689820 CTGAGCCCGGCCGCGGCCCCGGG - Exonic
1157464203 18:47930530-47930552 CCGGGCCCGGCCGGCGGCCCGGG + Exonic
1157584170 18:48790753-48790775 CCCCGCCCGGCTGGAGCCACGGG + Intronic
1157794109 18:50559633-50559655 CCCCGCGCGGCTGCAGCCGCCGG - Intergenic
1157833629 18:50879243-50879265 CCGCGCCCTGCCGCCCGCCCTGG - Exonic
1158435911 18:57435556-57435578 GCGAGCCCGCCCGCAGCCCGGGG + Intergenic
1158579674 18:58671068-58671090 CGGCTCCCGCCCGCAGTCCCCGG - Intergenic
1159511286 18:69400912-69400934 CCGCCCCCGGCAGCACCCACGGG - Intergenic
1159798223 18:72868195-72868217 CTGCGCGCGGCCGGCGCCCCGGG + Intergenic
1160195181 18:76748308-76748330 CCGCGCCCGGCCTCAACAACAGG - Intergenic
1160338560 18:78066361-78066383 CCACTCCCGCCCCCAGCCCCAGG + Intergenic
1160443502 18:78911334-78911356 CCACCCCAGGCCGAAGCCCCAGG + Intergenic
1160499402 18:79394762-79394784 CAGCGCCCGACCGCCTCCCCCGG + Intergenic
1160499803 18:79396044-79396066 CGGGGCCCGGCCGCGGCCCTAGG - Intronic
1160499884 18:79396357-79396379 CCCCGCGCGGCCTCCGCCCCCGG + Intronic
1160689762 19:456172-456194 GAGCCGCCGGCCGCAGCCCCCGG + Intronic
1160719125 19:589882-589904 CCGCCGCCGGCCGGAGCCCGAGG - Exonic
1160736652 19:665750-665772 CCGCGCCCGGCCCTTTCCCCTGG + Intergenic
1160835440 19:1122624-1122646 CCGCTCCCGCCCCCTGCCCCAGG + Intronic
1160859964 19:1233578-1233600 CCAGGCCCTGCTGCAGCCCCGGG + Exonic
1160930294 19:1567110-1567132 CCCCGCCCGGCCGGAGCCCCGGG + Intronic
1160960640 19:1719149-1719171 CCACGCGAGGCTGCAGCCCCAGG + Intergenic
1160988717 19:1851993-1852015 CCGCGCCGGCGAGCAGCCCCGGG + Intergenic
1161063706 19:2227537-2227559 CCCCGCCCCGCAGCAGCCCCAGG - Intronic
1161222029 19:3122309-3122331 CCGCCCCCGAGCGCCGCCCCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161479945 19:4505431-4505453 CCGCGTTCGGCCTCAGCTCCAGG + Intronic
1161674092 19:5633487-5633509 CCGCGCCTGGCTGCAGACCCTGG - Intronic
1162396520 19:10420654-10420676 CCGCGGCCGGGCGCACCCGCGGG + Exonic
1162700008 19:12507373-12507395 CTGCGCCCGGCCCCCACCCCCGG + Intronic
1162739886 19:12767831-12767853 CTGCGCCCAGCTGCAGCCGCGGG - Exonic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1162799973 19:13104945-13104967 CCTGGCCCAGCGGCAGCCCCAGG + Exonic
1162903474 19:13809159-13809181 CCGCGCCCTGCTGCCGCCACAGG - Exonic
1162909863 19:13842877-13842899 GCGCGGCCGGCGGCCGCCCCCGG - Intergenic
1163006255 19:14398377-14398399 CCGTGCCCGGCCTCAACTCCAGG - Intronic
1163158869 19:15453211-15453233 CCGCGCCCGGCCTTGGACCCGGG - Exonic
1163243051 19:16076203-16076225 CGGGGCCAGGCCGGAGCCCCGGG + Intronic
1163552619 19:17974059-17974081 CAGCCCCCGGGGGCAGCCCCAGG + Exonic
1163607143 19:18281578-18281600 CCGGCCGCGGCCGCAGCGCCCGG + Exonic
1164618510 19:29680566-29680588 CCGCTCCTGGGCTCAGCCCCTGG + Intergenic
1164693195 19:30225974-30225996 CGATGCCCGGCCGCAGCCGCCGG - Intergenic
1164713192 19:30373906-30373928 CGCGGCCCGGCCCCAGCCCCAGG + Intronic
1164826696 19:31289525-31289547 CCTCCCCGGGCCCCAGCCCCTGG + Intronic
1164836283 19:31357198-31357220 CCGCGCCAAGGGGCAGCCCCAGG - Intergenic
1165255972 19:34577500-34577522 CCGGGCCGCGCTGCAGCCCCGGG - Intergenic
1165274283 19:34734397-34734419 CTGAGCCCCGCCGCCGCCCCCGG - Intronic
1165355184 19:35299915-35299937 CCGCCTCCGGCCGCATCCCCAGG - Intronic
1165369528 19:35395870-35395892 CCTCGCTCCTCCGCAGCCCCGGG - Intergenic
1165375330 19:35437730-35437752 CCGCGCCCGGCTGGAGTCCATGG - Intergenic
1165419960 19:35717818-35717840 CCGCGGCCGGCCGGCGCCCTCGG - Intergenic
1165914156 19:39247728-39247750 CCGCGGCCGCCAGCAGCTCCAGG + Intergenic
1165957015 19:39507381-39507403 CCCCGCCGGGCCTCAGGCCCGGG + Exonic
1166043819 19:40218028-40218050 CCGGGCCCACCAGCAGCCCCGGG - Exonic
1166943620 19:46383914-46383936 CCACCCCCAGCCGCAGCCTCAGG + Intronic
1167134424 19:47608661-47608683 CCGCCCCCAGCCCCAGTCCCGGG - Intronic
1167590066 19:50399526-50399548 CCTGGCCCGGCCTCTGCCCCAGG - Intronic
1167590082 19:50399571-50399593 CCTGGCCCGGCCTCTGCCCCAGG - Intronic
1167703618 19:51065605-51065627 CCGCTCCCCGCCCCCGCCCCAGG + Intergenic
1168240550 19:55086853-55086875 CCGCGCCTGGCTGCAGGCCAAGG + Exonic
925068909 2:951015-951037 CCGCCCCCGGCCGCCTCCCGCGG + Exonic
925984733 2:9206734-9206756 GCCCGGCCGGCCGCCGCCCCCGG + Intergenic
926170631 2:10550631-10550653 CAGGGCCCGGCCACACCCCCTGG + Intergenic
927515729 2:23670570-23670592 CAGCCCCCCGCCGCAGGCCCTGG - Intronic
927851595 2:26503330-26503352 CCGCGCCCTCCAGCGGCCCCAGG + Intronic
928086189 2:28347851-28347873 CTGCCCCAGGCCCCAGCCCCGGG + Intergenic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
929242375 2:39665948-39665970 TCCCGCCCCGCCGCAGCCGCCGG - Exonic
929450361 2:42032877-42032899 CCGCCCCCGCCCCCACCCCCGGG - Intergenic
930872623 2:56184169-56184191 CCTTGCCCAGCTGCAGCCCCCGG - Exonic
931052304 2:58428486-58428508 GCGCGCGCGGCGGCCGCCCCGGG - Intergenic
931671795 2:64654059-64654081 CCGCGGCCGGCCGCGGCCGCAGG + Intronic
932562762 2:72887479-72887501 CAGCGTCCGGCCGAAGCCGCGGG - Exonic
933370650 2:81411312-81411334 CCGCGCCCGGCCTCACCTCCAGG - Intergenic
933588674 2:84207625-84207647 CAGCACCCGGCCTCAGCCTCTGG + Intergenic
933858579 2:86441903-86441925 CCGCGCGAGGACGCGGCCCCGGG - Intronic
934045517 2:88170265-88170287 CCGCCCCCCGCCCCATCCCCAGG + Intergenic
934079040 2:88452261-88452283 AAGGGCCCGGCCGCGGCCCCGGG + Exonic
934113686 2:88765108-88765130 GCGCGGCGGGCCGCAGCTCCGGG + Intergenic
934296871 2:91749176-91749198 CCGCGCACCGCGGCAGCCCCAGG + Intergenic
934797297 2:97112864-97112886 GCGCGGCCGGCCGCAGCTCCGGG + Intergenic
934836108 2:97590575-97590597 GCGCGGCCGGCCGCAGCTCCGGG - Intergenic
937134926 2:119544403-119544425 TCGCGCCCGGCCGCCGGCCCTGG + Intergenic
938054974 2:128208125-128208147 CCGTACCCGGCCACAGCCCCGGG + Intergenic
938427286 2:131202466-131202488 CAACCCCCGACCGCAGCCCCAGG - Intronic
938468231 2:131536514-131536536 CAACCCCCGACCGCAGCCCCAGG - Intergenic
940200554 2:151145415-151145437 CCTCTCCCGACCCCAGCCCCTGG - Intergenic
940316707 2:152335109-152335131 CGGCGCCCGGCCCCCGCCCCCGG - Intergenic
942083979 2:172427653-172427675 CTGCGCCCGGCCCCACCCCCGGG - Intronic
942116820 2:172736057-172736079 CGGCCCCCGGCTGCGGCCCCCGG - Intronic
943418661 2:187638006-187638028 CGGCGCCCGCCCGCAATCCCAGG + Intergenic
944242449 2:197499648-197499670 CCGCGCCGCACCGCAGGCCCAGG - Intronic
945404005 2:209423788-209423810 CCCCGCCCAGCCGCTGGCCCGGG - Intergenic
947549659 2:231037441-231037463 CCGAGCCCAGCCGGACCCCCGGG - Intergenic
947834301 2:233164214-233164236 CCAGCCCCAGCCGCAGCCCCTGG - Intronic
948369014 2:237475556-237475578 GCGCGCCCGGCTGCAGCCGTCGG + Intergenic
948618240 2:239215312-239215334 CCATGCCCGGCCTCAGCCCATGG - Intronic
948800078 2:240429542-240429564 CCTCCCTGGGCCGCAGCCCCAGG + Intergenic
948808422 2:240462850-240462872 CAGCGTCCAGCCCCAGCCCCTGG - Intronic
948903224 2:240966431-240966453 CCGCCCACGGCGGCACCCCCCGG + Intronic
1168769759 20:407957-407979 CCGGCCCCGGCCCCGGCCCCCGG + Intronic
1168769776 20:407986-408008 CCGGCCCCGCCCCCAGCCCCCGG + Intronic
1168930995 20:1623729-1623751 CCGCACACGGCAGCAGGCCCTGG + Intergenic
1169065625 20:2692960-2692982 CCCGGCCCTGCCGTAGCCCCGGG - Exonic
1169750071 20:8982524-8982546 CTGCCCCCAGCCCCAGCCCCTGG - Intergenic
1170150509 20:13221729-13221751 CCGCCGCCGGCCGCCGCGCCGGG + Intergenic
1170557980 20:17530993-17531015 GCGCGCCCGGCTGGAGCGCCAGG - Exonic
1170756810 20:19212495-19212517 CCCCGCCGCGCCGCCGCCCCAGG + Intergenic
1171034560 20:21705185-21705207 CCTTCCCCGGCCGCTGCCCCGGG + Intergenic
1172934472 20:38609854-38609876 CTGAGCCCGGCTGCAACCCCAGG + Intronic
1173666728 20:44768367-44768389 CCCCGCAAGGCTGCAGCCCCTGG - Intronic
1173815621 20:45985927-45985949 CAGCGCCCTGCTGAAGCCCCTGG - Intergenic
1174204338 20:48828018-48828040 CCGCGCGCTGCCTCCGCCCCCGG - Intergenic
1174846285 20:53946266-53946288 CCGCTCCCCACCGCAGACCCTGG + Intronic
1175153846 20:56955943-56955965 CCACGCCCGGCCTCAGACTCGGG + Intergenic
1175367717 20:58467216-58467238 CCGCCTGCAGCCGCAGCCCCGGG - Exonic
1175429597 20:58891935-58891957 CCGAGCCCGCCCCCCGCCCCGGG + Intronic
1175826322 20:61938411-61938433 CTGCCCCCTGCCGCAGCCCAAGG - Exonic
1175883914 20:62277385-62277407 CCGGCCCCGGGTGCAGCCCCTGG - Intronic
1176003203 20:62843750-62843772 CCGCTCCGGCCCCCAGCCCCTGG + Intronic
1176042373 20:63072333-63072355 CCGCGCCCCGCTGCTGCCCCCGG - Intergenic
1176077392 20:63254581-63254603 CCCGGCCCAGCCCCAGCCCCGGG + Intronic
1176129041 20:63488481-63488503 CCCCGCCCGGCCAGAGCCCTGGG - Intronic
1176143256 20:63554222-63554244 CCGGCCCCCGCCGCCGCCCCAGG - Exonic
1176162095 20:63653239-63653261 CCGCTGCCGGCCGCTGCCCCAGG + Intronic
1176221029 20:63969524-63969546 CCGCGCCCGCTCCCGGCCCCAGG - Intronic
1176229758 20:64026214-64026236 CCGCGCCCGGCCACCACGCCCGG - Intronic
1176298025 21:5084762-5084784 CTGCTCCCGGCCTCAGCTCCTGG + Intergenic
1178327772 21:31659576-31659598 CCGCCCCCTGCGGCAGCCTCGGG - Intergenic
1178454848 21:32739614-32739636 CCGCGCCCGGCCGTAACCACAGG - Intronic
1178584849 21:33863363-33863385 CCGTGCCCGGCCCCGGCCGCTGG - Intronic
1179484252 21:41699585-41699607 CCACGGCAGGCAGCAGCCCCTGG - Intergenic
1179798750 21:43800698-43800720 CTGGGCCCTTCCGCAGCCCCCGG + Intronic
1179810253 21:43865393-43865415 CCACGCCCCGCCGCCGCCCGAGG + Intronic
1179859004 21:44177187-44177209 CTGCTCCCGGCCTCAGCTCCTGG - Intergenic
1179893750 21:44350435-44350457 CCGCGCCCTGCAGCAGCACCGGG - Intronic
1180105773 21:45617214-45617236 CCACTCCCCGCTGCAGCCCCAGG + Intergenic
1180559340 22:16602341-16602363 CCGCGGGCGGCGGCAGCTCCCGG + Intergenic
1180960677 22:19761024-19761046 CCGTGCGCCGCCGCCGCCCCCGG + Exonic
1181478231 22:23181343-23181365 CCGGGACCGCCCGCAGGCCCGGG + Exonic
1182122665 22:27797715-27797737 CCGTCCCCGGCCGCCGCCCCCGG + Exonic
1182856056 22:33518597-33518619 CCGCGCCCGGCCTCAGGCACAGG + Intronic
1183299424 22:37051710-37051732 CCCCGCCCGCCCCCAGCGCCCGG + Intergenic
1183492287 22:38123060-38123082 CCCCGCCTGGCCCCATCCCCAGG + Intronic
1183591125 22:38779882-38779904 CAGAGCCAGGACGCAGCCCCAGG - Intronic
1183744793 22:39686148-39686170 CCGCCCCCGCCGCCAGCCCCCGG + Exonic
1183942270 22:41302341-41302363 GCGGGCCCGGCTGCAGGCCCCGG - Intronic
1184106301 22:42369221-42369243 CCGCGGCCGGCCGCTGGCCACGG + Intergenic
1184865713 22:47200893-47200915 CCCCGCCCCGCTGCAGCCACCGG - Intergenic
1184881376 22:47306524-47306546 CCGCGCCCGGCCAGAACCCCCGG - Intergenic
1185011424 22:48316733-48316755 CTGAGCCCGGCCTCAGCTCCGGG + Intergenic
1185255142 22:49827607-49827629 CCGGGCCCCGCCGCCGCTCCTGG + Intergenic
1185272380 22:49935318-49935340 CCGCGCCCCGCCGCCCGCCCGGG - Intergenic
1185335689 22:50270057-50270079 CCTCGCCCTGCCTCCGCCCCCGG - Intronic
1185374141 22:50474555-50474577 CCCCGCCCGGCCCCCGGCCCCGG + Intronic
949343086 3:3050471-3050493 CCGTGCCCGGCCTCAGAACCTGG - Intronic
950021710 3:9792415-9792437 CCGCCCCCTCCCGCGGCCCCTGG - Exonic
950578591 3:13847792-13847814 CCCCGCCCCACCCCAGCCCCTGG - Intronic
950837656 3:15936104-15936126 CCGCGCCCGGCCTAATCCTCAGG + Intergenic
952744505 3:36764439-36764461 CAGCGCCCGGCGACAGCCACCGG + Intergenic
952903119 3:38122417-38122439 CCGCCCCAGCCCTCAGCCCCAGG + Exonic
953326104 3:42013709-42013731 GCGCCCCCGCCCGCCGCCCCGGG + Intergenic
953907219 3:46874453-46874475 GGGCTCCCGGCCACAGCCCCCGG + Intronic
953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG + Intronic
954183413 3:48898959-48898981 CCGAGGCCGGAAGCAGCCCCGGG - Exonic
954364822 3:50140166-50140188 CAGTGCCCAGCCCCAGCCCCTGG + Intergenic
954539725 3:51385408-51385430 AGTCGCCCGGCCGCAGCGCCCGG - Exonic
954778848 3:53045286-53045308 GCGCGCCCGGCCCCAGCTGCGGG + Intronic
955384486 3:58468596-58468618 CCACGCCCGGCCCCAGAGCCAGG - Intergenic
956825994 3:72997148-72997170 CCGCGCCCGGCCCCGGTCCTCGG - Intronic
957048860 3:75396435-75396457 GCGTGGCCGGCCGCAGCTCCCGG - Intergenic
958026665 3:88058441-88058463 CCGCCCCCGCCCGAACCCCCGGG - Intronic
958779424 3:98522984-98523006 CCGGGCCGGGCCGCGGCCCGGGG + Intronic
958785719 3:98594182-98594204 CCGCGCCCGGCCCCAGCCTGGGG - Intergenic
960101168 3:113745581-113745603 CCACGCCGGCCCGCAGCTCCAGG - Intronic
960120793 3:113947674-113947696 CGGCGCCCGGCTGCCGCCTCTGG + Intergenic
961012933 3:123448179-123448201 CCGCGCCCCGCCGCTGCCGGCGG + Exonic
961346630 3:126267618-126267640 GCGCGCCCTGGCGCAGTCCCCGG + Intergenic
961446435 3:126983633-126983655 CCGAGCCCCGCGGCAGCTCCGGG + Intergenic
961664185 3:128486152-128486174 CCGCTCCCACCCCCAGCCCCTGG + Exonic
963133295 3:141877189-141877211 CCGCGCCGGGCGGGAGGCCCGGG - Intronic
963603079 3:147393674-147393696 CCGCGCCGGGGCGCAGTCGCCGG - Intronic
965763854 3:172109453-172109475 CCGCGCCCGGCCGAAGGCCTTGG + Intronic
966411771 3:179652896-179652918 CCGCCCCCCGCCGCCGCGCCCGG + Exonic
966913006 3:184569620-184569642 CCTCCCGCTGCCGCAGCCCCTGG - Intronic
966982717 3:185152995-185153017 CCGGACCCGGTCGCAGCGCCCGG - Exonic
967858543 3:194135208-194135230 CCGCGGGCGGCCTCGGCCCCCGG - Intergenic
968066535 3:195762351-195762373 CCCCTCCCGGCTTCAGCCCCAGG - Intronic
968353501 3:198081315-198081337 CCTGGCTCGGCCGCAGCCACTGG + Intergenic
968479235 4:826336-826358 CCGCCCCCCGCCCCCGCCCCCGG - Intergenic
968479289 4:826421-826443 CCGCCCCCCGCCCCCGCCCCCGG - Intergenic
968506443 4:973353-973375 CCGGCCCCGGCCCCGGCCCCGGG + Exonic
968514951 4:1011966-1011988 GCGCGCGCGGCCGCGACCCCAGG + Intronic
968541860 4:1172040-1172062 CCCAGCCCGGCCGCCGCCCTGGG - Exonic
968557336 4:1252743-1252765 CACTGCCCGGCCCCAGCCCCAGG + Intergenic
968631765 4:1655567-1655589 CCGCGCCCAGGCGCAGGCCTGGG - Exonic
968652732 4:1766640-1766662 CCGCGCTCAGCCACAGCCACAGG + Intergenic
968697921 4:2041847-2041869 CTGCTCCCGGGGGCAGCCCCCGG + Intronic
968965171 4:3766010-3766032 CCGCGCCCGGGAGCAGCCGGAGG + Intergenic
969346755 4:6575108-6575130 CCGCCCCCGCCCGCAGCCAATGG + Intergenic
971352215 4:25863993-25864015 CCCCGCCAGGCCGCAGAACCCGG - Intronic
975708730 4:77137345-77137367 CCACGCCCCCCCCCAGCCCCCGG - Intergenic
978646992 4:110945838-110945860 TGGCGCCCGGCCGCGGCCCAAGG + Intergenic
979122848 4:116926016-116926038 CCGTGGACGGCTGCAGCCCCAGG - Intergenic
979205647 4:118033890-118033912 CCGCGGACGGCTGCAGCCCCAGG + Intronic
981573206 4:146175840-146175862 ACGGGGCCGGGCGCAGCCCCAGG + Exonic
983576847 4:169270354-169270376 ACCGGCCGGGCCGCAGCCCCAGG - Intronic
984778803 4:183505702-183505724 CCTTGCCCGGCTGCAGTCCCGGG - Intronic
984966380 4:185143583-185143605 CTGCGCCAGGCCACAGGCCCGGG + Intronic
985512148 5:318929-318951 CCACGGCCGGCTGCAGCGCCAGG - Intronic
985666485 5:1183939-1183961 CCCACCCCGGGCGCAGCCCCAGG + Intergenic
986402485 5:7395045-7395067 CCGCGCCCAGCCGCTCTCCCCGG + Intergenic
986721297 5:10563425-10563447 CAGCGCCCAGTCGCAGCCTCCGG + Intergenic
987368672 5:17173236-17173258 TCTCGCCCAGCCCCAGCCCCTGG - Intronic
988264191 5:28928321-28928343 GCGTGGCCGGCCGCAGCTCCGGG - Intergenic
994171499 5:96662961-96662983 CTGCGCCGGGCCCCACCCCCAGG + Intronic
995142729 5:108750900-108750922 CCGCGCCCGGCCACATACGCTGG - Intronic
996900755 5:128538841-128538863 CCTCGCCCGGCCGCGGACCAGGG + Intronic
997177745 5:131796850-131796872 GCGCGCCCGGCCGCGACGCCCGG - Exonic
997521398 5:134526386-134526408 CTACGCCCGGCCGGAGCCCGCGG - Intronic
997583941 5:135033907-135033929 GCGCGCCCAGCCCCGGCCCCTGG - Exonic
997583978 5:135034036-135034058 CCGCCCGGCGCCGCAGCCCCGGG - Exonic
998138697 5:139688103-139688125 CCCCGCCCACCCGCAGCCCTGGG + Intergenic
998337908 5:141389732-141389754 CTTCGCCCGTGCGCAGCCCCAGG - Exonic
998341245 5:141419713-141419735 CCTCGCCTGTTCGCAGCCCCAGG - Exonic
999727022 5:154446034-154446056 CCGAGTCCCGCGGCAGCCCCTGG - Exonic
999996318 5:157095933-157095955 CCGCGCCCGGCCTCAGAGCTGGG - Intronic
1001641037 5:173244363-173244385 CCCCGGCTGGCCGCAGCTCCGGG + Intergenic
1001876727 5:175208057-175208079 CCGCGCCCGGCCAGAGCATCTGG - Intergenic
1002071322 5:176680355-176680377 CCGCGCCCGGGAGCCGGCCCAGG - Intergenic
1002280303 5:178125830-178125852 CCCCGCCCCACCCCAGCCCCTGG + Exonic
1002622102 5:180494940-180494962 CCGCCCCGGGCCGCGCCCCCGGG + Intronic
1003036336 6:2643617-2643639 CCTCTCCTGGCCCCAGCCCCTGG - Intergenic
1003139155 6:3456749-3456771 CCGAGCGGGGCCGCAGCGCCCGG - Intronic
1003551789 6:7107548-7107570 CCACCCCCCACCGCAGCCCCAGG - Intergenic
1003874865 6:10426285-10426307 CCGCCTCCCGCCGCAGCCCAAGG - Intergenic
1003911490 6:10747767-10747789 CCCCGCCCTGCCGCGGCCCCGGG + Exonic
1004650173 6:17600557-17600579 CCGGGCCGGCCCACAGCCCCGGG + Exonic
1004923946 6:20401915-20401937 CAGCTGCCGGCCGCAGCACCCGG + Intronic
1005098145 6:22141066-22141088 CCGCGCCCGGCCTTAGCTCAGGG + Intergenic
1005970329 6:30755993-30756015 CAGTGCCCAGCGGCAGCCCCAGG + Intergenic
1006024460 6:31138359-31138381 CCCCACCCAGCCCCAGCCCCAGG + Intronic
1006448503 6:34092769-34092791 CGGGGCCCTGCCCCAGCCCCGGG + Intronic
1007327654 6:41073808-41073830 CGGCGCCGGGCCGGAGACCCGGG - Intronic
1007401532 6:41605346-41605368 CCGCGCCCGGCCCCGGGGCCAGG - Intergenic
1007431574 6:41780109-41780131 CCGCGCCCCGCCTCCGCCGCAGG - Intronic
1007584202 6:42978866-42978888 CCGCGCCCGCACCCAGGCCCCGG + Exonic
1007625382 6:43243619-43243641 CCCCGCCCCGCCCCGGCCCCGGG + Intergenic
1007760091 6:44128226-44128248 ACGAGGCCGGCCGCTGCCCCCGG + Intronic
1008545179 6:52577280-52577302 CCGCGCCCGGCCGCATTCTCGGG + Intergenic
1008932446 6:56954873-56954895 CCCCGTCCGTGCGCAGCCCCCGG + Intergenic
1010001514 6:70954905-70954927 CCGCCCCCCCCCGCCGCCCCCGG - Intronic
1011075191 6:83431081-83431103 CCACGCCCGCCCCCAGCCGCTGG - Intergenic
1011277438 6:85643758-85643780 GCGCGCCCGGCCCCCGCCCCCGG + Intronic
1011734439 6:90297034-90297056 CCGCCCCCCGCCCCAGCCCCCGG - Intergenic
1013048896 6:106512697-106512719 CCCCGCCCGCCAGCGGCCCCCGG + Exonic
1013233097 6:108174719-108174741 CCTTGCCCGGCCGCAGGCCCTGG - Intronic
1015773517 6:136792191-136792213 CCCCGCCCAGCCGCACCGCCTGG + Exonic
1016328180 6:142926828-142926850 CCGCGCCCGGCGGCCGCCGCAGG - Intronic
1016590193 6:145735435-145735457 CGGCGCCCGGCCGGAGCTGCTGG - Exonic
1016738877 6:147508203-147508225 CCGCGCCCGCTGGCAGCCCAAGG - Intergenic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1016990631 6:149925678-149925700 CCGCTCCCGGACGATGCCCCTGG + Intergenic
1017103128 6:150865858-150865880 CCGCCGCCCGCCCCAGCCCCCGG + Exonic
1017793634 6:157823068-157823090 CCGCGCCGCGCCGCCGCCCCGGG - Intronic
1018774378 6:166999521-166999543 CCAGGCCCGGCCCCAGCCTCCGG - Intronic
1018960051 6:168441524-168441546 CCGCGCCCCGCTCCAGGCCCAGG + Intronic
1019303673 7:322342-322364 CCGGGCCCCGCCCCAACCCCCGG + Intergenic
1019342991 7:517314-517336 CCCCGCCCGGCCCCAGCTCGGGG + Intronic
1019517105 7:1444937-1444959 CCTCGCCCGGCCACACCCCAGGG - Exonic
1019524753 7:1475908-1475930 CCGCTCCCCGCCGCCGTCCCAGG - Intronic
1019525724 7:1479606-1479628 CCTCGCCCTGCAGCAGGCCCTGG - Exonic
1019765101 7:2844179-2844201 CCGCGCCCCGCCGGCGCCCGGGG + Exonic
1020125536 7:5530844-5530866 CGGCGCGCGCCCCCAGCCCCCGG - Intronic
1020234468 7:6345032-6345054 CCACGCCCGGCCACTGCGCCCGG + Intronic
1020383130 7:7567246-7567268 CCACGGCCGCCCGCAGCCCCCGG - Intronic
1022156019 7:27662713-27662735 CGGCTGCCGGCCGCAGCCGCCGG + Exonic
1022207611 7:28179786-28179808 CCGCCCGCGGCCGCCGGCCCCGG + Intronic
1022286179 7:28957527-28957549 CCGCGTCCGGCAGCGCCCCCAGG + Exonic
1022375349 7:29806821-29806843 CCCCGCCGGGCTGCAGCCCCGGG + Intronic
1022485026 7:30771442-30771464 CCACGCCGGGCCGCAGCACCAGG - Exonic
1022714967 7:32891317-32891339 CCGCACCCCGCGGCGGCCCCAGG - Intronic
1022722975 7:32957406-32957428 GCCCTCCCGGCCGCAGCTCCAGG - Exonic
1023736835 7:43242799-43242821 CCGCTCCCTGCCACAGCCACTGG - Intronic
1023870753 7:44261959-44261981 CGGGGCCAGGCTGCAGCCCCAGG - Intronic
1024639140 7:51316123-51316145 CCGGCCTCGGCGGCAGCCCCAGG - Intronic
1025007132 7:55363576-55363598 CCGCACCCGGCGGCTTCCCCAGG + Intergenic
1026523060 7:71132742-71132764 CCGCGCCTCGCCGGAGCCCGAGG + Exonic
1026805024 7:73424078-73424100 CAGAGCCCTGCCCCAGCCCCGGG - Intergenic
1028841539 7:95434755-95434777 CCACCCCCGGCCGCAGGGCCAGG + Intronic
1029080691 7:97971988-97972010 CAGGTCCCCGCCGCAGCCCCCGG + Intergenic
1029302853 7:99598508-99598530 CCGCCCCCAGCCCCTGCCCCGGG - Intronic
1029441088 7:100586901-100586923 CCCCGCCCGCCCCCAGCCCGGGG - Intronic
1029640566 7:101816838-101816860 CCGGCCCCGGCCGCCGCCCCCGG + Intronic
1030054934 7:105575745-105575767 CCGCACCCAGCTGAAGCCCCAGG - Intronic
1030081728 7:105784252-105784274 CTGCGCCCGGCCCCAGCTACAGG + Intronic
1030656634 7:112175151-112175173 CCGCGCCCAGCCCCGTCCCCTGG + Intronic
1032391284 7:131556712-131556734 CCCGGCCCGGCCGCCGCCGCTGG - Intronic
1033253183 7:139777786-139777808 GCGCGCCCGGCCCCCTCCCCCGG - Intronic
1033299659 7:140175821-140175843 CGGCGCCCGGGCACAGCCGCAGG + Intronic
1034560626 7:151877329-151877351 CCCCGCCGCGCCGCGGCCCCAGG + Intergenic
1034618090 7:152436065-152436087 CCCCGCCCGCCCGCACCCGCCGG - Intergenic
1037273697 8:17156402-17156424 CGCCGCCCGGCCGCCTCCCCTGG - Exonic
1037305152 8:17497032-17497054 CCGCGCCCCGCCCCCGCCCCGGG + Intergenic
1037878665 8:22561952-22561974 CCGCGCCCCTCCGCAGCCCTCGG - Intronic
1038002422 8:23403437-23403459 CAGCTCCCGGGCGCAGCCCCCGG + Intronic
1038406475 8:27326072-27326094 CCGGGCCCTTCCGCAGCCCCAGG + Intronic
1039453992 8:37696225-37696247 CAGTCCCCGGCCGCTGCCCCCGG + Intronic
1040512213 8:48105544-48105566 CCCCGCGAGGCGGCAGCCCCTGG - Intergenic
1041068145 8:54101862-54101884 GGGCGCCCGGCCGCGGCCCAAGG + Exonic
1041108000 8:54459657-54459679 CCGCGCCCGCCGCCCGCCCCGGG - Exonic
1043052790 8:75404290-75404312 CCGCGGCCAGAAGCAGCCCCGGG + Intergenic
1045305418 8:100952701-100952723 CCGCGCCCTGCCCCCGCCCCGGG - Intronic
1045432055 8:102123818-102123840 CCGGCCCCGGCCCCGGCCCCCGG + Intronic
1045547446 8:103141082-103141104 CCTCGCCCGCCCGCTACCCCGGG + Intronic
1047262279 8:123274049-123274071 CCGCGAGCGGGCTCAGCCCCAGG + Intronic
1047288697 8:123510319-123510341 CCGCGCCCGGCCCCAACTGCAGG - Intronic
1047393725 8:124475033-124475055 CCGCCCCCGGCCGCGGCCCCGGG + Exonic
1047615277 8:126557993-126558015 CCGCGCCCGCCCTCAGGCTCGGG + Intronic
1049146027 8:141001493-141001515 CCACGCCCGCGCGCAGCCTCGGG - Intronic
1049237254 8:141518555-141518577 CCGCGCGCGGGCGCAGCTCAGGG - Exonic
1049287235 8:141782424-141782446 CTGCGTCCTGCCGCAGCCACTGG - Intergenic
1049364113 8:142228362-142228384 CCCTGCCCGGCTGCAGCCCAGGG + Intronic
1049557614 8:143291004-143291026 CCGCGTGCTGCCACAGCCCCGGG + Intronic
1049585613 8:143431138-143431160 CCAGGCCCGGCCGCAAACCCAGG - Intergenic
1049641120 8:143716451-143716473 CGGCGCGCGGACGCACCCCCAGG - Intronic
1049668429 8:143859075-143859097 CGGGGCCCGGCCGCAGCTCCAGG - Exonic
1049668848 8:143860683-143860705 CGGGGCCCGGCCGCAGCTCCAGG - Exonic
1049669263 8:143862285-143862307 CGGGGCCCGGCCGCAGCTCCAGG - Exonic
1049669675 8:143863878-143863900 CGGGGCCCGGCCGCAGCTCCAGG - Exonic
1049670090 8:143865486-143865508 CGGGGCCCGGCCGCAGCTCCAGG - Exonic
1049762620 8:144337967-144337989 CCGCGCCCGGACGCTCCCCGGGG - Intergenic
1049769856 8:144374717-144374739 CCCCGCCCGCCCGCCGCCTCAGG - Intronic
1050094252 9:2047327-2047349 CCGCCCGCGGCCGCAGTGCCCGG + Exonic
1052837919 9:33265198-33265220 CCCCGCCCACCCCCAGCCCCGGG + Intronic
1052872635 9:33523643-33523665 CCTGGCTCGGCCGCAGCCACAGG - Intergenic
1052982322 9:34458319-34458341 CCGCGCGGGGCGGCGGCCCCAGG + Exonic
1053313828 9:37035812-37035834 CCGCGCCGGGAGGCAGCGCCTGG + Intergenic
1053813105 9:41875191-41875213 CCGCGCCCGGCCACCGCGCCCGG + Intergenic
1054617490 9:67312248-67312270 CCGCGCCCGGCCACCGCGCCCGG - Intergenic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1055501439 9:76906163-76906185 CCTCGCCCGGCCGCCGGCTCTGG + Intergenic
1055785205 9:79863731-79863753 CCGGCCCCGGCCCCGGCCCCGGG + Intergenic
1056350196 9:85741802-85741824 CCGCGCAGAGCCGCAGCACCCGG + Exonic
1056534949 9:87519141-87519163 CTGGGCCCGGCCGATGCCCCTGG + Intronic
1057225295 9:93289666-93289688 CGGAGCCCGGGCGCAGGCCCGGG + Intronic
1057347012 9:94259984-94260006 CCGCGCCCCACCCCAGCCGCCGG + Intronic
1057869686 9:98708606-98708628 CCGCGCCCAGCCCCAGGCCCCGG + Exonic
1058809456 9:108625575-108625597 CTGTGCCTGGCCCCAGCCCCAGG - Intergenic
1058908566 9:109499954-109499976 CCGGGCGGGGCCGGAGCCCCCGG + Intergenic
1059308041 9:113369965-113369987 CTGGGCCCCGCAGCAGCCCCAGG - Exonic
1060514625 9:124258094-124258116 ACCGGCCCGGCCCCAGCCCCAGG - Intronic
1060629510 9:125143305-125143327 CCGCCCCGAGCCGCTGCCCCTGG + Intronic
1060727260 9:126014865-126014887 CCACATCAGGCCGCAGCCCCTGG - Intergenic
1060971156 9:127738895-127738917 CCAGGCCCGGCCGGAGCTCCTGG - Exonic
1060986044 9:127819565-127819587 CCCGGCCCAGCAGCAGCCCCTGG + Intronic
1061150235 9:128824039-128824061 CCTGCCCTGGCCGCAGCCCCAGG + Intronic
1061208696 9:129178475-129178497 CCGCGCGGCGCGGCAGCCCCAGG - Intergenic
1061281000 9:129597586-129597608 CTGCGCCCGGCTGCAGCCGCGGG - Intergenic
1061472101 9:130835159-130835181 CCGCGCCCGTCCGCACCCAGGGG - Intronic
1061620596 9:131808975-131808997 CCGCTCCAGGCCCCAGCCACAGG - Intergenic
1061931981 9:133838041-133838063 CCGTGCACGGCCTCAGCGCCTGG + Intronic
1061986965 9:134135617-134135639 CTGCGCCCGGGCGCGGCCCCAGG + Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062390038 9:136330201-136330223 CCCTTCCCGGCCCCAGCCCCGGG - Intronic
1062442928 9:136579134-136579156 CAGCGCCCAGCCACATCCCCTGG - Intergenic
1062519197 9:136950617-136950639 GAGCGCCTGTCCGCAGCCCCAGG - Intronic
1062537682 9:137028039-137028061 ACGCGCCCGCCCTCAGCCCGAGG - Intronic
1062551034 9:137086597-137086619 CCCCGCCCGGGCGCCTCCCCGGG + Intergenic
1062558798 9:137130005-137130027 CGGCGCCCGGGCGCCTCCCCGGG - Intergenic
1062592127 9:137278862-137278884 CCAGGCCGGGCTGCAGCCCCCGG + Exonic
1062658964 9:137618578-137618600 CCGCGCCAGGCCGCGGCCCAGGG + Exonic
1186466310 X:9786563-9786585 CCGCGCGCGGCCCGAGCGCCTGG + Exonic
1187384049 X:18831409-18831431 CCGCGCCCGGCCCCCATCCCGGG - Intergenic
1187481261 X:19657905-19657927 CCGCCCCCACCCCCAGCCCCTGG - Intronic
1190984460 X:55488606-55488628 CCGCCCTCGGCCCCAGCCCCGGG - Exonic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1192814223 X:74574242-74574264 CCGCGCCCAGCCAGAGTCCCTGG + Intergenic
1195010941 X:100731797-100731819 CCTCTCCCGACCGCATCCCCAGG - Intronic
1197749852 X:129957071-129957093 TCGCGCCCCGCTGAAGCCCCAGG - Intergenic
1198047016 X:132913309-132913331 CTGCTCCAGCCCGCAGCCCCAGG - Intronic
1199248435 X:145632391-145632413 CCGGGCCCAGTGGCAGCCCCAGG - Intergenic
1200086641 X:153610329-153610351 CCGCCCCCCGCCGCAACCCCGGG - Intergenic
1200098231 X:153674004-153674026 CCCAGCCGGGCCGCAGCTCCGGG - Exonic
1200213790 X:154358563-154358585 CCAGGCCTGGCCCCAGCCCCAGG + Exonic