ID: 1072995030

View in Genome Browser
Species Human (GRCh38)
Location 10:100236069-100236091
Sequence ACAATTTGGAACTAGAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072995030_1072995034 16 Left 1072995030 10:100236069-100236091 CCAGTGCTCTAGTTCCAAATTGT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1072995034 10:100236108-100236130 TTTTTTTTTTTTTTAGAGACAGG 0: 693
1: 19202
2: 32507
3: 73520
4: 326226
1072995030_1072995035 17 Left 1072995030 10:100236069-100236091 CCAGTGCTCTAGTTCCAAATTGT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1072995035 10:100236109-100236131 TTTTTTTTTTTTTAGAGACAGGG 0: 693
1: 19289
2: 31780
3: 71445
4: 286608

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072995030 Original CRISPR ACAATTTGGAACTAGAGCAC TGG (reversed) Intronic
901416198 1:9118501-9118523 ACAAGTTGGAACTGGGGCCCAGG - Intronic
905637297 1:39563115-39563137 ACTAGTTGCATCTAGAGCACAGG + Intronic
906170044 1:43717400-43717422 ACAATATGGAACTACTGCATAGG + Intronic
906275500 1:44512426-44512448 ACAATTTGGATGTGGAGCTCTGG + Intronic
907339554 1:53725320-53725342 ACAATTGGGAACTCTAGGACAGG - Intronic
908287602 1:62624677-62624699 ACAATTTGGAAATAGGATACAGG + Intronic
908667180 1:66506392-66506414 GCAATTTGGAGCTAGAGGATGGG - Intergenic
909801482 1:79814869-79814891 ACAGTTTAGGACTAGAGCACAGG - Intergenic
919040028 1:192374140-192374162 AAAATTTGGAAATAAAGCAAGGG - Intergenic
923967138 1:239154549-239154571 ACAACTTGGAAGCAGAGCCCAGG + Intergenic
1064835145 10:19518596-19518618 AAAATTTGGAAATAGAGATCTGG - Intronic
1064946929 10:20801022-20801044 GAAGTCTGGAACTAGAGCACGGG - Intronic
1067384697 10:45807994-45808016 ACAATTTGGAATTAGAATTCTGG - Intergenic
1067487080 10:46660761-46660783 AGAAATTGGAAGTAGAGCACAGG - Intergenic
1067607724 10:47681215-47681237 AGAAATTGGAAGTAGAGCACGGG + Intergenic
1071623282 10:87142612-87142634 AGAAATTGGAAGTAGAGCACGGG + Intronic
1072538517 10:96381111-96381133 GCAATAGGAAACTAGAGCACAGG - Intronic
1072995030 10:100236069-100236091 ACAATTTGGAACTAGAGCACTGG - Intronic
1077791473 11:5445075-5445097 ACAATTAGTGACTAGAGCACTGG - Intronic
1082617703 11:55381360-55381382 GCATTTTGCAACTTGAGCACTGG + Intergenic
1082990947 11:59206767-59206789 ACCATTTGGAAAGAGAGCAAAGG - Exonic
1083372310 11:62192118-62192140 GCAAGTTGGAACTTGAACACAGG - Exonic
1085095903 11:73760632-73760654 ACATTGTGGAACTAGAGGAGCGG + Exonic
1086319021 11:85625652-85625674 ACAATCTGAAACTAAAGCTCTGG - Intronic
1086642056 11:89170890-89170912 ACACTTTGAAACTGGAGCAGAGG + Intergenic
1090047297 11:123347093-123347115 ACGGTTTGGAAGTAGAGCAAGGG - Intergenic
1090104974 11:123843333-123843355 TTAACTTGAAACTAGAGCACTGG - Intergenic
1091112259 11:132980750-132980772 TCCATTTGGAACTAGAACAACGG + Intronic
1096664479 12:53154022-53154044 TCAATTTGGAACGAGAGGAGTGG + Intergenic
1099568216 12:84279447-84279469 ACTATTGGGAACTGGAGCAAAGG - Intergenic
1103651266 12:122434372-122434394 ATAATTTGGAACTAGAGGAAAGG + Intergenic
1104955648 12:132464680-132464702 CCAACTGGGAACCAGAGCACAGG - Intergenic
1105227271 13:18447773-18447795 CCTATTGGGAACTAGAGCAAAGG + Intergenic
1106085598 13:26539216-26539238 AGAATTTGGAACCAGAGCCAAGG + Intergenic
1106243144 13:27925786-27925808 GCAGTGTGGAACTGGAGCACAGG - Exonic
1106891819 13:34254133-34254155 TCAATCTGGAACTAGAGAAAAGG + Intergenic
1107655004 13:42583281-42583303 AGCAGTTGGAACTACAGCACAGG - Intronic
1108896332 13:55333778-55333800 ACTACTGGGAACTAGAGCAAAGG + Intergenic
1114011720 14:18376227-18376249 CCTATTGGGAACTAGAGCAAAGG + Intergenic
1119684942 14:76624067-76624089 ACAAATGGGAAATGGAGCACCGG - Intergenic
1125034322 15:35106534-35106556 ACCAGTTGGATCTGGAGCACAGG + Intergenic
1129193544 15:73951587-73951609 ACAATCTGGGACTAGGGCATGGG + Intronic
1129266157 15:74394314-74394336 AACATGTGGAACTGGAGCACAGG - Intergenic
1130747740 15:86674278-86674300 ACAGTTTGGTACCAGAGAACTGG + Exonic
1135580134 16:23618452-23618474 ACATTTTTGTACTAGAGCACCGG + Intronic
1137494669 16:48960621-48960643 ACAATGTGGACCTTGAGCAGAGG - Intergenic
1140049607 16:71468455-71468477 ACAAGTAGGAACTGGGGCACTGG - Intronic
1143962721 17:10733922-10733944 ACACTCTGGACATAGAGCACAGG - Intergenic
1144184030 17:12779300-12779322 AAAATTTGGAACAAGATTACAGG - Intergenic
1144316327 17:14065423-14065445 ACAAGATGGAACTAGAGTATAGG + Intergenic
1148075528 17:44933338-44933360 ACAAGTCTGAACTAGACCACTGG + Intronic
1148905233 17:50907778-50907800 ACCATTAGGAACTGGAGCTCTGG - Intergenic
1149791053 17:59477767-59477789 ACATTTTTGAACTGGAGCCCAGG - Intergenic
1157160183 18:45306938-45306960 ACAAACTGGAACTAGGGCAAAGG + Intronic
1158442665 18:57490929-57490951 ACACTTTGGAAATATAGCGCAGG - Exonic
1158787395 18:60731264-60731286 ACACTTTGGAAATACAGCAAAGG - Intergenic
1168083004 19:54024101-54024123 ACAACTTGGACCTAGAGCTGGGG + Intergenic
925475661 2:4211343-4211365 CAAACTGGGAACTAGAGCACAGG + Intergenic
925816626 2:7757928-7757950 ACAATTTAGTTCTAGAGCTCGGG + Intergenic
926756968 2:16244279-16244301 AGAACTTGGAACTAAAGCCCAGG + Intergenic
930224822 2:48781299-48781321 ACCATATGGAACAAGAGCCCAGG - Intergenic
933688283 2:85160142-85160164 GGAATTTGGAACTATAGCAGTGG - Intronic
937891120 2:126939817-126939839 ACAGTTGGGAAATGGAGCACAGG + Intergenic
946585774 2:221185867-221185889 ACAATTTGGAAATAGCAAACAGG - Intergenic
947333218 2:229052103-229052125 AAAATTTGGAAATAGAGAAGTGG - Intronic
1169318988 20:4615733-4615755 ACAATTGGGAACTAGTGACCTGG - Intergenic
1176771316 21:13076787-13076809 CCTATTGGGAACTAGAGCAAAGG + Intergenic
1177854131 21:26382965-26382987 ATAGTTTGAAACTAGAGCAAAGG + Intergenic
1180436213 22:15307035-15307057 CCTATTGGGAACTAGAGCAAAGG + Intergenic
1180752453 22:18133912-18133934 AGAATTTGGAACTGGAGCAGGGG - Intronic
1185125224 22:49006850-49006872 ACAATTGGGAACTAGAACAGAGG - Intergenic
1185403910 22:50634430-50634452 CCATTTTTGAACTAGACCACTGG - Intergenic
949469105 3:4375879-4375901 ACACTTTGTACCTAGAACACGGG + Intronic
949523315 3:4877515-4877537 TCATTTTGGAACTACAGCAAAGG + Intronic
950621281 3:14207524-14207546 AAACTTTGGAAGTAGAGCCCAGG + Intergenic
952358962 3:32610813-32610835 ACACCTTGCAACTAGGGCACTGG + Intergenic
954327653 3:49872369-49872391 AGAGTTTGGAACAAGAGCAGAGG + Intergenic
954837724 3:53484621-53484643 ACAATTTAGAACTAGAATAATGG - Intergenic
963238368 3:142977534-142977556 ACCATTTGGAGATAGAGCCCTGG - Intronic
963658891 3:148098404-148098426 ACAAATTAGAAAAAGAGCACTGG + Intergenic
963723398 3:148890454-148890476 AGAATATGGAAAAAGAGCACTGG - Intronic
964598762 3:158471015-158471037 ACAATGTTGGACTAGAGCCCAGG + Intronic
964639794 3:158896488-158896510 ACGATTTGCAGCTAGAGCAAAGG - Intergenic
966498485 3:180609073-180609095 ATATTTTAGAACTAGAGCAGTGG + Intronic
966659205 3:182395583-182395605 ACAGATTGGAAAGAGAGCACAGG + Intergenic
970827116 4:20289453-20289475 AAAATTTGGAAATAGAAAACTGG - Intronic
971815873 4:31488062-31488084 TCATTGTGGAAGTAGAGCACTGG - Intergenic
971898101 4:32622699-32622721 TCAATTTGTTCCTAGAGCACAGG - Intergenic
972821811 4:42710289-42710311 AAAACTTGCAACTAGAGAACTGG - Intergenic
973240451 4:47950834-47950856 ACTTTTAGGAAATAGAGCACTGG - Intronic
973614146 4:52662376-52662398 ATTATTGGGAACTAGAGCAAAGG - Intergenic
973925772 4:55735794-55735816 ACAATTTTGAGTTAGAGCACAGG + Intergenic
975191787 4:71472369-71472391 ACAATTTGCAAGCATAGCACTGG - Intronic
982716258 4:158811717-158811739 ACAACTTGGAACCAGTGGACAGG + Intronic
982864592 4:160493947-160493969 ACAAGTTGGGAGTAGAGCACAGG + Intergenic
983156817 4:164358123-164358145 ACATTATGCAACTAGAGCCCAGG + Intronic
983909868 4:173225953-173225975 CCAATTTGGAGCAAGAGGACTGG + Intronic
985076699 4:186223473-186223495 ACTATTGGGAACTGGAGCAAAGG + Intronic
986201524 5:5583672-5583694 ACAATTGGCAGCTAGAGAACGGG - Intergenic
986503037 5:8420555-8420577 ACATTTTGGAAGTGGAGAACAGG + Intergenic
988099331 5:26657531-26657553 CTAATTTGGAACTGGAGCAAAGG - Intergenic
988755945 5:34249985-34250007 ACAAATTTGGACTTGAGCACGGG + Intergenic
989106535 5:37868210-37868232 ACAATTAGGAAATACAGAACAGG - Intergenic
991744209 5:69715839-69715861 ACAAATTTGGACTTGAGCACGGG + Intergenic
991753497 5:69839398-69839420 ACAAATTTGGACTTGAGCACGGG - Intergenic
991795781 5:70295563-70295585 ACAAATTTGGACTTGAGCACGGG + Intergenic
991803114 5:70396125-70396147 ACAAATTTGGACTTGAGCACGGG - Intergenic
991823583 5:70591106-70591128 ACAAATTTGGACTTGAGCACGGG + Intergenic
991832816 5:70714522-70714544 ACAAATTTGGACTTGAGCACGGG - Intergenic
991888151 5:71295081-71295103 ACAAATTTGGACTTGAGCACGGG + Intergenic
992512995 5:77458855-77458877 TCAATTTGAAATTAGAGCAAGGG - Intronic
993118670 5:83747922-83747944 AAAATTTGTTACTAGAGAACAGG - Intergenic
993251137 5:85524557-85524579 AGAATTTGGTACTAGAGAAGTGG + Intergenic
994589214 5:101753031-101753053 ATAATTTGTACCTAGAACACTGG + Intergenic
996435526 5:123429461-123429483 ACATTCTGGAACTACAGCAAAGG + Intergenic
998420143 5:141977475-141977497 AATATTTTTAACTAGAGCACAGG - Intronic
1000423643 5:161065000-161065022 GCAATTTAGCACTTGAGCACAGG + Intergenic
1001598404 5:172913350-172913372 ACATTGTGGATCTAGAGGACAGG + Intronic
1001927704 5:175650590-175650612 ACTATTGGGAACCAGAGCAAAGG - Intergenic
1003308397 6:4948301-4948323 ACATTTTGGAAGTGGAGCCCTGG + Intronic
1003424195 6:5986206-5986228 ACAAAAAGGAACTAGAGAACAGG - Intergenic
1005554593 6:26961779-26961801 ACAAATTTGGACTTGAGCACGGG + Intergenic
1007952316 6:45883425-45883447 ACAAGGTGGAAGTAGAGCATGGG + Intergenic
1008973005 6:57391766-57391788 CCAATTTCAAACTACAGCACAGG - Intronic
1009161911 6:60293296-60293318 CCAATTTCAAACTACAGCACAGG - Intergenic
1009672858 6:66778868-66778890 AGAATTTGGAACTAGAATAAGGG - Intergenic
1010320471 6:74503299-74503321 ACAATGTGGAACTAAAATACTGG + Intergenic
1011724892 6:90200286-90200308 ACAAGTTTGAACTAGACCAGTGG - Intronic
1014296938 6:119629923-119629945 AGAATTTGGAATTAGAAGACAGG + Intergenic
1014695472 6:124615554-124615576 ACATTTTGGAACTAGCATACAGG + Intronic
1015590984 6:134822988-134823010 CAGATTTGGAACTAGAGCCCAGG + Intergenic
1018522201 6:164662909-164662931 ACAATTTGAATATAGAGCAAAGG + Intergenic
1022188611 7:27995209-27995231 AAAATCTGGAACTAGAACATTGG + Intronic
1023113158 7:36834523-36834545 TCAAGTTGGAAGTAGTGCACAGG - Intergenic
1023396411 7:39755825-39755847 TGAAATTGGAACTAGAGCACAGG - Intergenic
1031581596 7:123481675-123481697 GCAACTTGGAACTAGAGAAAAGG + Intronic
1031950068 7:127882479-127882501 TTATTTTGGAAATAGAGCACTGG + Intronic
1032716487 7:134513216-134513238 ACAATCTGGAACTCAAGCCCAGG - Intergenic
1036789160 8:11706811-11706833 ACAAGAGGGAACTGGAGCACTGG - Intronic
1039516986 8:38142379-38142401 ACCATTTGGAGATAGAGCTCTGG - Intronic
1040323723 8:46330770-46330792 ACAGTTTGGGACTAGAGATCCGG - Intergenic
1041548948 8:59078916-59078938 ATAATTGGGAACTACAGCAAAGG + Intronic
1046375568 8:113375827-113375849 ATAATTTGGAACTAGAATAATGG + Intronic
1046396021 8:113640852-113640874 ACACATTGGAACTATAGGACTGG - Intergenic
1049085901 8:140478366-140478388 AAACTTGGGAACTAGAGCAAAGG - Intergenic
1053149801 9:35736215-35736237 ACTAGTAGGACCTAGAGCACAGG - Exonic
1053703922 9:40730520-40730542 CCTATTGGGAACTAGAGCAAAGG - Intergenic
1054414005 9:64854129-64854151 CCTATTGGGAACTAGAGCAAAGG - Intergenic
1055297427 9:74848889-74848911 ACATTTTGGAAATTGAGCTCTGG - Intronic
1186970915 X:14841569-14841591 ATAATTTGCAACAAGAGTACAGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1189654162 X:43224086-43224108 AAAGTTTGGAGCTAGAGTACTGG - Intergenic
1192597693 X:72428739-72428761 CCATTTTGAAACTAGAGAACTGG - Intronic
1193046289 X:77058373-77058395 CTTATTTGGAACTAGAGCAAAGG + Intergenic
1193965919 X:87986452-87986474 AAAATTAAGTACTAGAGCACTGG + Intergenic
1194019885 X:88674512-88674534 AGAATTTGAAAGTAGAGCATAGG + Intergenic
1196692823 X:118578984-118579006 ACATTTGGGAACTATAGGACTGG - Intronic