ID: 1073001325

View in Genome Browser
Species Human (GRCh38)
Location 10:100288172-100288194
Sequence AGCCACCATGGAAACCCACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 454}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073001322_1073001325 5 Left 1073001322 10:100288144-100288166 CCAAGTTTTCCTAAGGAGTTTTA 0: 1
1: 0
2: 0
3: 24
4: 245
Right 1073001325 10:100288172-100288194 AGCCACCATGGAAACCCACATGG 0: 1
1: 0
2: 5
3: 48
4: 454
1073001320_1073001325 24 Left 1073001320 10:100288125-100288147 CCAGAAGCAAATGCAAAGTCCAA 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1073001325 10:100288172-100288194 AGCCACCATGGAAACCCACATGG 0: 1
1: 0
2: 5
3: 48
4: 454
1073001323_1073001325 -4 Left 1073001323 10:100288153-100288175 CCTAAGGAGTTTTATTGATAGCC 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1073001325 10:100288172-100288194 AGCCACCATGGAAACCCACATGG 0: 1
1: 0
2: 5
3: 48
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073001325 Original CRISPR AGCCACCATGGAAACCCACA TGG Exonic
901272019 1:7959653-7959675 AGCCACTATGGAAAACAATATGG + Intronic
901777792 1:11572356-11572378 AGCCACCACATTAACCCACATGG - Intergenic
904281244 1:29420272-29420294 AACCACTATGGAAAACAACATGG - Intergenic
906183778 1:43844169-43844191 AGCCTCCATAAAAACCCAAAAGG - Intronic
906348748 1:45038879-45038901 AGCCACCATGCTAACCAACAAGG + Intronic
906483744 1:46219009-46219031 AGCCACCATGCCCAGCCACAGGG - Intronic
906867954 1:49442854-49442876 AGCCACCATGGAAACCAGTATGG - Intronic
907278758 1:53331477-53331499 AGCCAGCATGCGAACCCAGAGGG + Intergenic
909547789 1:76867597-76867619 ACCCATCATGGAAACCCTCCAGG + Exonic
909802331 1:79826104-79826126 AGCCACTATGGAAAACAATATGG - Intergenic
910715270 1:90223441-90223463 AGCCTCCATGAAACCCCAAAAGG - Intergenic
910738522 1:90489605-90489627 AGCCACTATGGAAAACAACATGG - Intergenic
911373282 1:97020107-97020129 AGCCACTATGGAAAACTGCATGG + Intergenic
911700178 1:100943460-100943482 AGCCTCCATAAAAACCCAAAAGG - Intronic
912468502 1:109890502-109890524 CACCACCATAGCAACCCACATGG - Intergenic
913532616 1:119743407-119743429 GGCCACCAGGGACAGCCACAGGG - Intronic
913665611 1:121045598-121045620 AGCCACTGTGGAAACCCATATGG + Intergenic
913721104 1:121596389-121596411 AGCCACTATGGAAAGCAATATGG - Intergenic
914017009 1:143828868-143828890 AGCCACTGTGGAAACCCATATGG + Intergenic
914160777 1:145132130-145132152 AGCCACTGTGGAAACCCATATGG - Intergenic
914655618 1:149737410-149737432 AGCCACTGTGGAAACCCATATGG + Intergenic
914981475 1:152418450-152418472 AGACACCATGGTAAGCTACATGG + Intergenic
915786343 1:158616833-158616855 AGCCACTATGGAAACCAGTATGG - Intronic
916212407 1:162369699-162369721 AACCACCATGGAACACCCCAAGG - Exonic
916672701 1:167037674-167037696 AGCCACTATGGAAAACAGCATGG - Intergenic
919017912 1:192064488-192064510 AGCCATCATGGAAACCTGTATGG + Intergenic
919222434 1:194646589-194646611 AGCCACCATGGAAAACCATATGG - Intergenic
919975148 1:202605576-202605598 AGCCACCAGAGACACTCACAGGG + Exonic
920808966 1:209264414-209264436 AGCCACCATAAAAACCCAAAAGG + Intergenic
921259304 1:213371514-213371536 AGCCACTATGGAAAACAGCATGG - Intergenic
921884573 1:220292541-220292563 AGCCACTATGGAAAACAATATGG - Intergenic
922529155 1:226329970-226329992 AGCCACCTTGGAAATCCATTTGG - Intergenic
923471751 1:234297219-234297241 AGCCACCATGGAAAACAGTATGG + Intronic
923803393 1:237232352-237232374 AGCCTCCATAAAAACCCAAAAGG + Intronic
924953674 1:248907588-248907610 ATGCACCATGAAAAGCCACAGGG - Intronic
1063068750 10:2637525-2637547 TTCCCCCATGGAAATCCACAAGG - Intergenic
1063357026 10:5410839-5410861 AGCCAGCAGGGCAACCCACTGGG - Intergenic
1063689469 10:8272658-8272680 TGGCACCATGGAAACCCCCTGGG + Intergenic
1064293162 10:14053731-14053753 AGCCACCATGCCCAGCCACAAGG - Intronic
1065053688 10:21820963-21820985 GGCCTCCATAAAAACCCACAAGG - Intronic
1066679737 10:37926048-37926070 AGCTACTATGGAAAACCGCATGG + Intergenic
1067269902 10:44782198-44782220 AGTCACTATGGAAAACCATATGG + Intergenic
1068455962 10:57254287-57254309 ACTCACTATGGGAACCCACAGGG - Intergenic
1068879588 10:62034550-62034572 AATCACCAGGGAAACACACATGG - Intronic
1069175438 10:65284027-65284049 AGCCCCCATAAAAACCCAAAAGG + Intergenic
1069555797 10:69397224-69397246 AGCCACTGTGGAAAACAACATGG - Intronic
1069763343 10:70831699-70831721 AGCCTCCATAAAAACCCAAAAGG - Intronic
1069804202 10:71107658-71107680 AGGCACCCTGCAAAGCCACAAGG + Intergenic
1070073725 10:73114980-73115002 AGCCACCATAAAAACCCAAAAGG + Intronic
1071753984 10:88514958-88514980 AGCCACTATGGAAAACAATATGG - Intronic
1071999458 10:91179921-91179943 AGCCACCATGGAAAACAGTATGG - Intronic
1072433497 10:95394532-95394554 AGCCACCAGGAAAAACCCCAAGG + Intronic
1073001325 10:100288172-100288194 AGCCACCATGGAAACCCACATGG + Exonic
1074186475 10:111103060-111103082 ACCCACAACGAAAACCCACAAGG - Intergenic
1075066968 10:119295386-119295408 AGCCACTATGGAAAACCATGTGG + Intronic
1075324694 10:121521732-121521754 AGCCACCATGGAAAACAATATGG + Intronic
1075746294 10:124730278-124730300 ACCCAGCATGCAAACACACATGG + Intronic
1077571655 11:3344739-3344761 AGCACCCTTGGAAATCCACATGG + Intronic
1077990540 11:7406767-7406789 AACCACTATGGAAAACAACATGG - Intronic
1078547004 11:12253842-12253864 AGCCTCCATAGAAACCGAAAAGG - Intronic
1079726347 11:23884875-23884897 AGCCACCAAGAAAACCCACAAGG - Intergenic
1079823816 11:25165088-25165110 AGCCACTATGGAAAACAATATGG - Intergenic
1080823613 11:35829663-35829685 AGCCTCCATAAAAACCCAAAAGG - Intergenic
1080993939 11:37578325-37578347 AGCCACTATGGAAAACAGCATGG + Intergenic
1081880896 11:46450726-46450748 AGCCACCATGTACAGCCACAAGG + Intronic
1082728853 11:56770529-56770551 TGCCACAATGGAAACACACCTGG - Intergenic
1082772127 11:57215998-57216020 AGCCACCATGGAAAACAGTATGG - Intergenic
1083117707 11:60479161-60479183 AGCCACCATGGAAAACAGTATGG - Intergenic
1083155272 11:60819037-60819059 AGGCACCACTGAAACCCACCAGG + Intergenic
1083458420 11:62794744-62794766 AGCCAGGATGAAAACCCAGACGG + Intronic
1083878436 11:65536878-65536900 GGGCACCAAGGAAGCCCACAGGG - Intronic
1084242358 11:67830673-67830695 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1087138918 11:94746631-94746653 AGCCAAAATGGAAAACCACCAGG - Intronic
1087899375 11:103623296-103623318 AGCCACCATGGAAAACACTATGG + Intergenic
1088109369 11:106244817-106244839 AGCCTCCATAAAAACCCAGAAGG - Intergenic
1088434032 11:109790864-109790886 AGCCACCATGGAAAACAATATGG + Intergenic
1088531402 11:110813940-110813962 AGCCACTATGGAAAACAATATGG - Intergenic
1088584720 11:111352626-111352648 AGACACTAAAGAAACCCACATGG + Exonic
1089047229 11:115512701-115512723 AGCCACAATGTAAACCCAGAGGG - Intergenic
1089168120 11:116493360-116493382 AGCCACCACGGAACCCCTCCTGG - Intergenic
1089444117 11:118538069-118538091 AACCACTATGGAAAACCATATGG - Intronic
1089962606 11:122629127-122629149 AGGCCCCAGGGAAAGCCACAAGG + Intergenic
1090197955 11:124833026-124833048 AGCTTCCATGAAAACCCAAAAGG - Intergenic
1090975702 11:131678268-131678290 AGACCCCACTGAAACCCACATGG - Intronic
1091202433 11:133792199-133792221 AGCCACTATGGAACACCGCACGG + Intergenic
1091264766 11:134261980-134262002 AGCCCTCCTGGAATCCCACAAGG + Intronic
1091598323 12:1896725-1896747 AGCCACTATGGAAAACAATATGG + Intronic
1091650913 12:2308909-2308931 AGCCATTATGGAAAACAACATGG + Intronic
1091745379 12:2988801-2988823 AGCCACCATAGACACCTAGAAGG + Intronic
1092665049 12:10787066-10787088 AGCCATTATGGAAAACCATATGG - Intergenic
1092853030 12:12647988-12648010 AGCCTCCATGGATGCCCTCATGG + Intergenic
1093183303 12:15991029-15991051 AGCCATCATGGAAAACAATATGG - Intronic
1093477891 12:19574768-19574790 AGCCACCAGTGAAACTCACCAGG - Intronic
1093639649 12:21511407-21511429 AGCCTCCATAAAAACCCAAAAGG - Intronic
1093927245 12:24921120-24921142 AGCCTCCATGAAAATCCAAAGGG - Intronic
1094440366 12:30469210-30469232 AACCACCATGGAAAACAACATGG - Intergenic
1095052746 12:37568696-37568718 AGCCTCCTTAGAAACCCAAAAGG + Intergenic
1098325356 12:69296679-69296701 AGCCACTGTGGAAAACCATATGG + Intergenic
1098506203 12:71253511-71253533 AGCCTCCATGATAACCCAAAAGG - Intronic
1100187854 12:92156925-92156947 GGCCGCCATAGAAACCCAAAAGG + Intergenic
1100404362 12:94260567-94260589 AGCTTCCATGGAAACTCCCATGG + Intronic
1100428882 12:94512686-94512708 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1100537266 12:95522992-95523014 AGCCTCCATAAAAACCCAAAAGG + Intronic
1100807986 12:98307682-98307704 AGCAACAATGGAAAGCCTCAAGG - Intergenic
1101111776 12:101493447-101493469 GGCCACTATGGAAAACAACATGG - Intergenic
1101792946 12:107946822-107946844 AGCCACTATGGAAACCAGTATGG + Intergenic
1102294980 12:111729515-111729537 AGCCACCATGGCCGGCCACAAGG + Intronic
1102429573 12:112872114-112872136 AGCCACCATGGAAAACGGAATGG - Intronic
1103266609 12:119635988-119636010 AGCCCCCATGCAAACCCAAAAGG - Intronic
1103274408 12:119699601-119699623 AGCCAGCGTGGAAAGCAACAAGG + Intronic
1103616818 12:122158849-122158871 AGCCACCATGGAAAACAGCCAGG + Intergenic
1105013540 12:132771982-132772004 AGCCACGGTGGAATCACACAGGG + Exonic
1105923168 13:24983807-24983829 AGCCTCCATAAAAACCCACGAGG + Intergenic
1106055463 13:26232770-26232792 AGCCAACATTGAAAACCACTGGG - Intergenic
1106565893 13:30884388-30884410 AGCCACTATGGAAAACAATATGG + Intergenic
1106679267 13:31993436-31993458 AGCCACTATGGAAAACAACATGG - Intergenic
1108261602 13:48662429-48662451 AGCCACCATGGAGAACTATATGG - Intronic
1108866098 13:54924452-54924474 AGCCATCATGGAAAACCATATGG - Intergenic
1110042984 13:70788794-70788816 AGCCATTATGGAAAACAACATGG + Intergenic
1110513762 13:76384317-76384339 AGACACAAGGGCAACCCACAGGG + Intergenic
1111044253 13:82794468-82794490 AGCCTCCATAAAAACCCAAAGGG - Intergenic
1112340951 13:98552621-98552643 AGCCACCCTGGACCTCCACAAGG - Intronic
1112939765 13:104847580-104847602 AACCTCCATGGAAACCCATGCGG + Intergenic
1113183254 13:107656577-107656599 AGCCACTATGGAAAACAATAGGG + Intronic
1113883730 13:113646254-113646276 AGCCACTATGAAAAACCAAATGG + Intergenic
1114294493 14:21316832-21316854 AGCCACCATGCCCAGCCACATGG - Intronic
1115130015 14:30043512-30043534 AGCCACTATGGAAAACTATATGG - Intronic
1115559438 14:34569953-34569975 AGCCACTATGGAAAACCATATGG - Intronic
1115567731 14:34639144-34639166 AGCCTCCATAAAAACCCACAAGG - Intergenic
1116363384 14:44029492-44029514 AGCCTCCATAAAAACCCAAAGGG - Intergenic
1117883357 14:60333590-60333612 AGCCACTATGGAAAACAGCATGG + Intergenic
1117929787 14:60829009-60829031 AGCCCCCATAAAAACCCAAAAGG - Intronic
1118975227 14:70670933-70670955 AGCCACCATGGATAGGCAGAAGG + Intronic
1119127128 14:72137817-72137839 AGCCTCCATAAAAACCCAAAAGG - Intronic
1119251629 14:73160472-73160494 AGCCACCATGGAAAACAATATGG - Intronic
1119433576 14:74583907-74583929 ACCCACCATGGGAACCGGCAGGG + Intronic
1120180528 14:81338338-81338360 AGCCTCCATAGAAAACCAAAAGG + Intronic
1120469388 14:84903458-84903480 GGCCACCATGGAAGCCACCATGG - Intergenic
1120521007 14:85528718-85528740 TGCCACCTTGGAAACTCAGAAGG + Exonic
1120687398 14:87554100-87554122 AGCCACTATGGAAAACAATATGG + Intergenic
1121242137 14:92438760-92438782 AGCCTCCATAGAAACCCTAAAGG - Intronic
1121251599 14:92503836-92503858 AGCCAGCATGGAGAACCACTGGG - Intergenic
1121680188 14:95787221-95787243 ATCCAGCATGGAGTCCCACATGG + Intergenic
1124490805 15:30153914-30153936 AGCCACCAGGGACACTCACAGGG + Intergenic
1124516120 15:30368558-30368580 AGCCTCCATAAAAACCCAAAAGG + Intronic
1124726800 15:32162173-32162195 AGCCTCCATAAAAACCCAAAAGG - Intronic
1124752727 15:32384415-32384437 AGCCACCAGGGACACTCACAGGG - Intergenic
1125059185 15:35398445-35398467 AGCCTCCATGAAAACCCGAACGG + Intronic
1125876673 15:43153914-43153936 AGCCACCATGGAAAACAGTATGG - Intronic
1126763732 15:51992941-51992963 AGCCCCCATAAAAACCCAAAGGG - Intronic
1126945279 15:53812340-53812362 AGACACCATGGAATACTACAGGG - Intergenic
1126971437 15:54116845-54116867 AGCCACTATGGAAAACTATACGG - Intronic
1128298501 15:66545986-66546008 AGCCACCATGGAAAGAGAGAGGG + Intronic
1128679703 15:69639374-69639396 AGCCACCATGGAAAACAATTTGG - Intergenic
1128958207 15:71972172-71972194 AGCCTCCATAAAAACCCAAAAGG + Intronic
1130416297 15:83697742-83697764 AGCCTCCATGAAAACTCAGAAGG - Intronic
1131165876 15:90141930-90141952 CGACACAATGGAAACTCACATGG - Intergenic
1131426069 15:92346445-92346467 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1133007578 16:2893149-2893171 AGCCTCCATAAAAACCCAAAAGG - Intronic
1133139183 16:3731778-3731800 TGCCACCATGGAGAAGCACAAGG - Exonic
1133223651 16:4329680-4329702 AGCCCCCAGGGAAACACACGGGG + Intronic
1133703672 16:8333035-8333057 AGCTACAGTGGAAACACACAAGG + Intergenic
1134007867 16:10830147-10830169 ATGCACTATGGAAAGCCACAGGG - Intergenic
1134164749 16:11920946-11920968 AGCCTCCATAGAAACCCAGAAGG - Intergenic
1134780898 16:16894688-16894710 AGCCACCATGGAAAACAGTATGG + Intergenic
1135221560 16:20619127-20619149 AGCAACCTTGGAAATCCATATGG + Intronic
1137373690 16:47932544-47932566 AGCCTCCATAGAAACCCAAGAGG - Intergenic
1137693183 16:50443738-50443760 AGCCATCATGGAAAACTGCATGG + Intergenic
1137862454 16:51860219-51860241 AGCCACCTTGAAAACAGACAAGG + Intergenic
1138460163 16:57143298-57143320 AGCCACCATGCCCACACACAGGG - Intronic
1139003355 16:62541024-62541046 AGCCTCCATAGAAACCTAAAAGG - Intergenic
1139023103 16:62777020-62777042 AGCCACTATGGAAAACAGCATGG + Intergenic
1139640682 16:68289390-68289412 AGCCTCCAGGGACATCCACATGG - Intronic
1140629050 16:76829938-76829960 AGCCACTATGGAAACCAGAATGG + Intergenic
1140758574 16:78090905-78090927 AGCCACCATGCTCATCCACATGG - Intergenic
1142299886 16:89250536-89250558 AGCCACCTCGGAAACCCATTTGG - Intergenic
1142766148 17:2065340-2065362 AGCCACCATGGAGGCCCAGGTGG - Intronic
1143837177 17:9701664-9701686 AACCACCATGGCAACCTGCAAGG + Exonic
1144009388 17:11131907-11131929 AGCCACTATGGAAAACAATATGG - Intergenic
1144483221 17:15644490-15644512 AGCCTCCATATAAACCCAAAAGG - Intronic
1144770344 17:17756013-17756035 AGCCACCATGGAAAGCCAGGAGG + Intronic
1145099852 17:20065614-20065636 AGCCTCCATAAAAACCCAAAAGG - Intronic
1145104636 17:20104950-20104972 AACCACCATGGAGAGCCACTAGG + Intronic
1145373265 17:22324631-22324653 AGCCTCCTTGCAAACCCAAAAGG + Intergenic
1148187605 17:45655968-45655990 ACCCACCATGGAAACCATCATGG + Intergenic
1148193149 17:45694043-45694065 AGCCACCATGGAAATCAATCTGG - Intergenic
1148407871 17:47435437-47435459 AACCACTATGGAAAACAACATGG + Intronic
1148442069 17:47716585-47716607 AGCCACCACAGAAACCCACAGGG - Intergenic
1148498064 17:48066465-48066487 AACCACCATACAAACCAACAAGG + Intergenic
1148752169 17:49951651-49951673 ACCCACCCTGGAAACCCAACAGG + Intergenic
1148850130 17:50550607-50550629 TGCCACCATGGACACACACCCGG - Exonic
1149146217 17:53496743-53496765 AGCCTCCATAGAAACGCAAAAGG + Intergenic
1149660001 17:58329295-58329317 GGCCACCAGGGAAGCCCACATGG + Intergenic
1150058373 17:62040950-62040972 AGCCACCATGGAAAGCAGTATGG + Intronic
1150172289 17:63010929-63010951 AGCCTCCATAAAAACCCAAAAGG - Intronic
1150454042 17:65292844-65292866 GGTCACCATGGAAACCCTGAAGG - Intergenic
1150867660 17:68870916-68870938 AGCCACTATGGAAAGCAATATGG - Intronic
1150938061 17:69659101-69659123 AGCCTCCATAGAAACCCACAAGG + Intergenic
1151949606 17:77343315-77343337 AGCCTCCCTGAAAACCCAAAAGG + Intronic
1152127345 17:78455193-78455215 AGCCACCATGCAATGCCACTGGG + Intronic
1152388801 17:79991167-79991189 AGCCACCCTGGAGACCCAGCTGG + Intronic
1153725187 18:7947012-7947034 GGCCACCCTAGAAAACCACAAGG - Intronic
1153803737 18:8694178-8694200 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1154235310 18:12600019-12600041 GGCCACGTTGGGAACCCACATGG + Intronic
1154412432 18:14148663-14148685 AGCAGCCATGGCAATCCACAGGG + Intergenic
1155166685 18:23237594-23237616 AGCCACCAAGGAACTCCAAACGG - Intronic
1156096369 18:33537573-33537595 AGCCACTATGGAAAACGATATGG + Intergenic
1156118195 18:33812516-33812538 AGCCAACATGGAAAGCTCCATGG + Intergenic
1156567656 18:38213794-38213816 AGCCACTATGGAAAGCCATTAGG - Intergenic
1156806684 18:41191446-41191468 AGGCATCATGGGTACCCACAAGG - Intergenic
1157347383 18:46852040-46852062 TGCCACCATGGAGAGCCTCAGGG - Intronic
1157768199 18:50319456-50319478 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1158573493 18:58616543-58616565 AGCCTCCATAAAAACCCAAAAGG + Intronic
1159468919 18:68823628-68823650 AGCCACCATGGAAAGCAATTCGG - Intronic
1160093975 18:75853713-75853735 AACAAACATGGAAACCAACAAGG - Intergenic
1160442229 18:78901694-78901716 AGCCACTGTGGACACACACAGGG - Intergenic
1160832749 19:1111308-1111330 AGCTGCCCTGGAAACCCACCCGG + Intronic
1161137094 19:2626279-2626301 CGGCACCGTGGAAACCCACCGGG + Intronic
1161655662 19:5513083-5513105 GGCCACCATGGAGACACGCAAGG + Intergenic
1164883040 19:31752118-31752140 AGCCTCCAGAGAAACCCAAAAGG + Intergenic
1165508360 19:36249554-36249576 AGCCTCCATGAAAACCCAAAAGG - Intergenic
1165632188 19:37311224-37311246 AGCCTCCATGAAAATCCAAAAGG + Intergenic
1165735336 19:38172227-38172249 AGCCACCCTGGACTCTCACATGG - Intronic
1166581480 19:43903750-43903772 AGCCTCCATTGATACCCACAGGG - Intergenic
1168451205 19:56467894-56467916 AGCCACCATAAAAACTCAGAAGG - Intronic
925128440 2:1477708-1477730 AGCCATCATGGGCGCCCACATGG + Intronic
925301870 2:2822281-2822303 AGCCACTATGGAAACCAGTATGG + Intergenic
927131127 2:20061714-20061736 TTCCACTATAGAAACCCACATGG - Intergenic
927271666 2:21216801-21216823 AGCCACCATGGAAAACATTATGG + Intergenic
929063959 2:37953765-37953787 AGCCACTATGGAAAACAATATGG - Intronic
930339558 2:50095262-50095284 AACCACCAGGGAAGTCCACAGGG - Intronic
931365853 2:61618129-61618151 TGCCACCATGCAGAGCCACATGG - Intergenic
932632279 2:73355179-73355201 AGCCTCCATAAAAACCCAAAAGG - Intergenic
932824302 2:74925709-74925731 AGCCACCAAATAAGCCCACAAGG - Intergenic
933035058 2:77386040-77386062 AGCCACCATGCCCAGCCACATGG + Intronic
934027172 2:88010703-88010725 AGCCTCCATAAAAACCCAAAAGG - Intergenic
935220250 2:101005715-101005737 AGCCACCATTGATACCCAACCGG - Intronic
935544765 2:104389186-104389208 AGCCATCGTGGAAAACAACATGG + Intergenic
935654986 2:105414282-105414304 AGCCTCCATGAAAACCCTAAAGG - Intronic
935710010 2:105889829-105889851 TGCCACCATGGCATCCCAAAGGG + Intronic
937276828 2:120690334-120690356 AACCAAAATGGAAACCCAAATGG - Intergenic
937286907 2:120759650-120759672 AGCCTCCATAAAAACCCAAAAGG - Intronic
938241500 2:129745704-129745726 AGCCACCATGGAAAACAGTATGG + Intergenic
938872153 2:135490564-135490586 AGCTGCCATGGAAACCAATATGG + Intronic
939100196 2:137886975-137886997 AACTCCCATGGAAACCCACCTGG - Intergenic
940253521 2:151705493-151705515 AGCCACCATGGAAAACAGTATGG + Intronic
940855314 2:158724709-158724731 AGCCACAGGGGAGACCCACATGG - Intergenic
941037999 2:160588775-160588797 AGCCACTATGGAAACCAGTATGG - Intergenic
943077170 2:183209544-183209566 AACCATCAGGGAAACCCAAAAGG - Intergenic
943102127 2:183499777-183499799 AGCCACTATGGACAACTACATGG - Intergenic
943254549 2:185577154-185577176 AACCACTATGGAAAACAACATGG - Intergenic
944620421 2:201509070-201509092 AGCCACTATGGAAAACAACATGG - Intronic
945144680 2:206725294-206725316 AGCCATTATGGAAAACAACATGG - Intergenic
947141437 2:227022616-227022638 TGACACTATGGAAACCCACGTGG - Intronic
947286649 2:228524143-228524165 AGCCTCCATGGAAAACAATATGG + Intergenic
947967214 2:234291409-234291431 AGCTTCCATGAAAACCCAAAAGG - Intergenic
948065785 2:235078119-235078141 AGCCTCCATTAAAACCCAGAAGG - Intergenic
1168832021 20:851183-851205 ATCCCTCTTGGAAACCCACATGG - Intronic
1169584579 20:7066874-7066896 AGCCACTATGGAAAACCATGTGG + Intergenic
1171374935 20:24685914-24685936 GGACACTCTGGAAACCCACACGG - Intergenic
1172308779 20:33900842-33900864 AGCCTCCATCAAAACCCAAAAGG + Intergenic
1172967557 20:38848488-38848510 AGCCACAATATAAACCTACAAGG - Intronic
1173171575 20:40729131-40729153 AGTCCCCATTGAAATCCACAAGG - Intergenic
1175176477 20:57115340-57115362 GGCCACCCAGGAAACCCAAATGG + Intergenic
1175494862 20:59406839-59406861 AGCCTCAGTGTAAACCCACAGGG + Intergenic
1175523862 20:59620074-59620096 AGTAACCATGGAAACACACCGGG - Intronic
1176860571 21:14009593-14009615 AGCAGCCATGGCAATCCACAGGG - Intergenic
1176876114 21:14130810-14130832 AGCCACCAGGAACACCAACATGG + Intronic
1177059962 21:16359372-16359394 AGCCACTATGGAAAACAACATGG - Intergenic
1177212347 21:18086972-18086994 AGCTACCAGGAACACCCACATGG - Intronic
1178590513 21:33905625-33905647 AGCCACCGTGCACAGCCACAAGG - Intronic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1179378565 21:40877146-40877168 AGCCACTTTGGAAACCAACTGGG + Intergenic
1179883322 21:44302483-44302505 ACCCACCATGGGGAGCCACACGG - Intronic
1180163221 21:46007159-46007181 AGCCACCACGCAGACCCCCACGG + Intergenic
1180597064 22:16984367-16984389 AGCCACTATGGAAAACAATATGG + Intronic
1180909417 22:19438569-19438591 AGCAGCCATGGAAAGCCATATGG - Intronic
1183111697 22:35654185-35654207 AGCCTCCATAGAAACCCAAAAGG - Intronic
949271513 3:2223254-2223276 TACCACCACGGACACCCACAGGG - Intronic
949535704 3:4994954-4994976 AGGCAGCATGGACACCCACCTGG + Intergenic
949588009 3:5462206-5462228 AGCCATCATGGAAAACAGCATGG + Intergenic
949922981 3:9018427-9018449 AGCCACTATGGAAAACAGCATGG - Intronic
951096004 3:18632105-18632127 AGCCACCATGGAAAGCAATTTGG + Intergenic
951490217 3:23262042-23262064 AGCCACTAAGGAAACCAATATGG - Intronic
951654823 3:24994077-24994099 AGCCACCATGGAGATCCATATGG - Intergenic
952302796 3:32119188-32119210 AGCCACTGTGGAAAACCAAATGG - Intronic
952834345 3:37590939-37590961 AGCCACCCTGATAACCCCCAGGG - Intronic
952879072 3:37971674-37971696 TGTCACCATGGTAACCCAGAAGG - Intronic
953220213 3:40963290-40963312 AGCCACCATGGAAAACAGTATGG - Intergenic
953650894 3:44802670-44802692 AACCACCATGGAAAGCAACTTGG - Intronic
956056179 3:65301154-65301176 AGCCTCCATAAAAACCCAAAAGG - Intergenic
956370085 3:68549736-68549758 AGCCTCCATAAAAACCCAGAAGG - Intergenic
956425982 3:69135564-69135586 AGCCACTATGGAAAACAGCATGG + Intergenic
956653735 3:71529665-71529687 AGCCTCCATAGAAACTCAGAAGG + Intronic
957240965 3:77660876-77660898 GGCCACCATGAAAAGCCCCAGGG + Intergenic
957921274 3:86751567-86751589 AACCACCATGGAAAACAATATGG - Intergenic
958111677 3:89155547-89155569 AGCCACCATGAAAATCAAAATGG - Intronic
960551403 3:118980080-118980102 AGCCACTATGGAAAACAATATGG + Intronic
961173201 3:124813759-124813781 TGCCTCCATGAAAACCCAGAAGG - Intronic
961310204 3:125992610-125992632 AGCCACTATGGAAAACAATATGG + Intergenic
961684059 3:128617488-128617510 AGCTGCCCTGGAAAGCCACAGGG - Intergenic
962378116 3:134875496-134875518 AGCCCCCAGGGAAACCCGGATGG + Intronic
962591272 3:136891609-136891631 AGCCACTGTGGAAACCCATATGG - Intronic
964145608 3:153458897-153458919 AGCCACCATGAAAAACAGCATGG + Intergenic
964601580 3:158506741-158506763 AGCCACTATGGAAACCAGTATGG + Intronic
966645702 3:182244497-182244519 AGCCAGCAAGGAGGCCCACAAGG - Intergenic
967058701 3:185852369-185852391 AGCCAACCTGAAAACACACAAGG + Intergenic
967487240 3:190047290-190047312 AGCCACTATGGAAACCAATATGG + Intronic
967559328 3:190900115-190900137 AGTCACTATGGAAAACAACATGG + Intergenic
967944224 3:194789799-194789821 AGCCACTATGGAAAACAATATGG - Intergenic
968712927 4:2133234-2133256 AGCCACTATGGAAAACAATATGG + Intronic
969314689 4:6374699-6374721 AGCCCCCAAGGAAACAGACATGG - Intronic
971502432 4:27331621-27331643 ACCACACATGGAAACCCACATGG - Intergenic
971503752 4:27344200-27344222 AGCTACCATGGAGATCCATATGG - Intergenic
972912802 4:43838974-43838996 AGCCATTATGGAAAACAACATGG + Intergenic
975526707 4:75358658-75358680 AGCCACCATGAAAAGCCAGTTGG - Intergenic
977235785 4:94505854-94505876 AGCCTCCTTAAAAACCCACAAGG - Intronic
977357652 4:95967554-95967576 AGCCTCCATAAAAACCCAAAAGG - Intergenic
978210120 4:106125143-106125165 AGCCACTATGGAAAACAGCATGG + Intronic
978990320 4:115073233-115073255 AGCCACTATGGAAAACAATATGG + Intronic
980622220 4:135322651-135322673 AGCCACCATGGAAAGCAGCTTGG + Intergenic
981205230 4:142033116-142033138 AGCCTCCTTGGAGACCCACATGG - Intronic
982058866 4:151582623-151582645 AATCACCATGTAAAACCACAAGG - Intronic
983609442 4:169626346-169626368 AGCCTCCATAAAAACCCAAAAGG - Intronic
984649952 4:182260311-182260333 AGCCACTATGGAAAACTATATGG - Intronic
985617724 5:934091-934113 AGCCACCATGGCAACTTTCATGG + Intergenic
987398504 5:17449556-17449578 ATCCATTATGGAAACCCATATGG - Intergenic
987460086 5:18198468-18198490 AGCCACCCTGCAAAGCCACAGGG + Intergenic
988134664 5:27155438-27155460 AACCACAATGGAAAACAACATGG - Intergenic
989958566 5:50383444-50383466 AGCCACTATGGAAAGCAATATGG + Intergenic
990113034 5:52351466-52351488 AGCCTCTATGGAAAACCATATGG - Intergenic
990363634 5:55047286-55047308 AGCCTCCATCAACACCCACAGGG + Intergenic
990760247 5:59121635-59121657 AGCCACTATGAAAACCAGCATGG + Intronic
991287893 5:64999909-64999931 AGCCACCATGGAAAACAGTATGG - Intronic
991521275 5:67499838-67499860 AGCCACTATGGAAAACCATTTGG - Intergenic
991697694 5:69288435-69288457 AGCCTCCATAAAAACCCAAAAGG + Intronic
991954935 5:71985097-71985119 AGCCACCATGCCCACCCACGTGG + Intergenic
992789081 5:80197713-80197735 AGGCACCCTGGGAAGCCACATGG - Intronic
993362681 5:86997629-86997651 AGCCATGAGAGAAACCCACATGG - Intergenic
993489823 5:88533626-88533648 AGCTGCTATGGAAACCGACATGG + Intergenic
993821332 5:92620610-92620632 AGCCACCATGGAAAGCAATTTGG - Intergenic
994000069 5:94768803-94768825 AGCCATTATGGAAATCAACATGG + Intronic
994438541 5:99769963-99769985 AGCCACCATGGAAAGCATCGTGG + Intergenic
995109978 5:108418178-108418200 AGCAACCATGGAACCCCAAAGGG - Intergenic
995130392 5:108624093-108624115 AGCCTCCATAAAAACCCAAAAGG + Intergenic
995175236 5:109168486-109168508 AGCCTCCATAAAAACCCAAAAGG + Intronic
996288500 5:121824034-121824056 AGCCACTATGGAAAACAGCATGG - Intergenic
996642729 5:125776705-125776727 AGCCTCCATAGGAACCCAAAAGG - Intergenic
997418123 5:133744817-133744839 AATCACCATGGAAACCCAAGTGG - Intergenic
997671565 5:135679146-135679168 AGCCACCATGAAAACCAAAATGG - Intergenic
998497229 5:142601436-142601458 AGCCTCTATGGCAACCCACCTGG + Intronic
998917623 5:147032939-147032961 AGCCACTATGGAAAACAATAAGG - Intronic
999190909 5:149746672-149746694 AGCCACCATGGAAAACAGTATGG - Intronic
999648375 5:153741321-153741343 AGCCACTATGGAAAACAATATGG + Intronic
999765407 5:154736891-154736913 AGCCACCATGGAAAACCATATGG - Intronic
1000609269 5:163356671-163356693 AGCCACCGTGGCAACCCGCTTGG + Intergenic
1001561286 5:172670555-172670577 AGCCAGGATTGGAACCCACATGG + Intronic
1001776627 5:174333722-174333744 AGCCACTATGGAAAACAGCATGG - Intergenic
1001838570 5:174853453-174853475 AGCCACCATGGAAAGCTTCAAGG - Intergenic
1002618319 5:180469018-180469040 AGCCACCAGAGATGCCCACACGG + Intergenic
1002857434 6:1050670-1050692 AGCCTCCATGAAAACCCAAAAGG - Intergenic
1002999556 6:2318419-2318441 AGCCTCCATAAAAACCCAAAAGG - Intergenic
1003191410 6:3878442-3878464 ACCCACCAGGGACACCCACATGG + Intergenic
1003400091 6:5783887-5783909 AGCCTCCATAAAAACCCACGAGG + Intergenic
1005722788 6:28619238-28619260 AGCCTCCATAAAAACCCAGAAGG + Intergenic
1006251753 6:32793075-32793097 AGCCTCCATTAAAACCCAAAAGG - Intergenic
1006288166 6:33113848-33113870 AAACGCCATGGAAACCCTCAAGG + Intergenic
1007801427 6:44397014-44397036 AGCCTCCATAAAAACCCAAAAGG - Intronic
1007937932 6:45750478-45750500 AGCTTCCATAGAAACCCAAAAGG + Intergenic
1008974602 6:57409990-57410012 AACCAACAAGGAAACCAACAAGG - Intronic
1009163490 6:60311499-60311521 AACCAACAAGGAAACCAACAAGG - Intergenic
1009631202 6:66202988-66203010 AGCCACCATGGAGCCCCAAGGGG - Intergenic
1010413062 6:75582591-75582613 AACCACCATGGAAAACCATGTGG - Intergenic
1011239787 6:85258694-85258716 AGCCTCCATAAAAACCCAAAAGG - Intergenic
1011586705 6:88933914-88933936 AGCCACCATGGAAAACAGTATGG - Intronic
1011650957 6:89505657-89505679 AGCCATTATGGAAAGCCATATGG + Intronic
1011783535 6:90818013-90818035 AGCCACTATGGAAAACTATATGG - Intergenic
1014498734 6:122159872-122159894 AGCCACCATGGAAAGCAATTTGG - Intergenic
1015073577 6:129127593-129127615 AGCCATTATGGAAAACTACATGG - Intronic
1015515452 6:134078653-134078675 AGCCTCCATAAAAACCCAGAAGG - Intergenic
1015789779 6:136954960-136954982 TGCCACCATGGAATGCCTCAGGG - Intergenic
1015925411 6:138305108-138305130 ATCCACCAGTGAAACCAACAGGG - Intronic
1016601079 6:145861513-145861535 AGCCACTATGGAAAACAATATGG + Intergenic
1017650235 6:156574328-156574350 AGCCACCATGGAAAACAGTATGG - Intergenic
1018068080 6:160137566-160137588 AGTATCCATGGAAACCCACCAGG - Intronic
1018549171 6:164975074-164975096 AGCCACTATGGAAAACAATATGG - Intergenic
1018703994 6:166450092-166450114 AACCACCATGGGGACCAACATGG + Intronic
1020274808 7:6617444-6617466 AGCCACCTTGGAAAATCTCAAGG - Intronic
1020334481 7:7052157-7052179 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1022080029 7:27011090-27011112 AGCCACTATGGAAACCAGTATGG - Intergenic
1022138284 7:27469370-27469392 AGGCACTATGGATTCCCACAGGG + Intergenic
1022986258 7:35657428-35657450 AGCCACTATGGAAAACAATATGG + Intronic
1023575411 7:41621366-41621388 AGCCACCATGTACACGCAGAAGG + Intergenic
1024470687 7:49766603-49766625 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1024902053 7:54330455-54330477 AGCCTCCATAAAAACCCAAAAGG - Intergenic
1025237147 7:57242407-57242429 AGCCACCGTGGAAAACAATATGG - Intergenic
1026317215 7:69237689-69237711 AGCCTCCATGAAAACCTAAAAGG - Intergenic
1026460457 7:70610325-70610347 AGCCATTATGGAAAACAACAGGG - Intronic
1026526524 7:71158205-71158227 AGCCACTATGGAGAACCATATGG - Intronic
1027730107 7:81860627-81860649 AGCCACTATGGAAACCAGTATGG + Intergenic
1028084381 7:86617972-86617994 AGCAACCATGGAAAACTATATGG + Intergenic
1028182575 7:87743388-87743410 AGCCACTATGGAAAACAGCATGG - Intronic
1028932505 7:96428738-96428760 TGCCATCATTGAAACCCAAAGGG + Intergenic
1030077239 7:105747307-105747329 AGCCTCCATAAAAACCCAAAAGG + Intronic
1030327532 7:108236464-108236486 GGCCACCTTGGAAACTGACAAGG - Intronic
1033446689 7:141429085-141429107 AGCCATTATGGAAAACCATATGG + Intronic
1033613562 7:142989006-142989028 AGCCTCCATGGAAAACAATATGG - Intergenic
1033848592 7:145465473-145465495 AGCCACTATGGAAAACAATATGG - Intergenic
1034420545 7:150988531-150988553 AGCCACCTTGGGACCCCAGATGG + Intergenic
1034651093 7:152690824-152690846 AGCCAGCATGGGAGCACACAAGG + Intergenic
1035243834 7:157549858-157549880 ATCCCACAGGGAAACCCACATGG + Intronic
1036264096 8:7261232-7261254 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036265391 8:7268854-7268876 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036266693 8:7276476-7276498 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036267999 8:7284098-7284120 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036269303 8:7291720-7291742 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036297290 8:7547704-7547726 ATGCACCGTGGAAAGCCACAGGG + Intergenic
1036298593 8:7555359-7555381 ATGCACCGTGGAAAGCCACAGGG + Intergenic
1036299898 8:7563009-7563031 ATGCACCGTGGAAAGCCACAGGG + Intergenic
1036316136 8:7719771-7719793 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036317445 8:7727419-7727441 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036318753 8:7735067-7735089 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036320060 8:7742714-7742736 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036321369 8:7750362-7750384 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036322678 8:7758010-7758032 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036323983 8:7765659-7765681 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036325290 8:7773315-7773337 ATGCACCGTGGAAAGCCACAGGG - Intergenic
1036353357 8:8026294-8026316 ATGCACCGTGGAAAGCCACAGGG + Intergenic
1037178890 8:15979847-15979869 AGCCACTATGGAAAACAATATGG - Intergenic
1037585994 8:20276431-20276453 AGCCTCCATAAAAACCCAAAAGG + Intronic
1037695099 8:21216701-21216723 AGGCACCGAGGAAACCCACTGGG - Intergenic
1037814567 8:22105116-22105138 AGCCACCATGCACAACCACCTGG - Intergenic
1038301099 8:26349559-26349581 AGCCACTATGGAAAACAACGTGG - Intronic
1038463484 8:27737647-27737669 AGCCACTATGGAAAACAGCAAGG + Intronic
1038499960 8:28035598-28035620 AGCCACCATGGAAACTTCCATGG + Intronic
1038850220 8:31268399-31268421 AGCCTCCATCAAAACCCAAAAGG - Intergenic
1040831593 8:51683065-51683087 AGCCACCATGGAAAACAGTATGG - Intronic
1040932381 8:52748469-52748491 TGCCTCCATGAAAACCCAAAAGG - Intergenic
1041758705 8:61340756-61340778 AGCCATCATGGAAAACAATATGG - Intronic
1042962139 8:74315153-74315175 CACCACCACGGAAACCTACATGG - Exonic
1043029165 8:75109842-75109864 AGCCATCATGGAAAACTGCATGG - Intergenic
1043030481 8:75128334-75128356 AGCCTCCAGGGAAACCAACCGGG + Intergenic
1043690032 8:83140025-83140047 AGCAAGCATGGCAACCCACTGGG - Intergenic
1043937424 8:86157428-86157450 AGCCACTATGGAAGGCCAGATGG - Intergenic
1044098735 8:88102513-88102535 AGCCACCATAAAAACCAAAATGG - Intronic
1044468288 8:92534054-92534076 AGCAACAACAGAAACCCACAAGG + Intergenic
1044816927 8:96123058-96123080 AGCCACAATGGAAAACATCATGG - Intergenic
1045939884 8:107727234-107727256 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1047746120 8:127846285-127846307 AGACACCATGGACACCCACCAGG - Intergenic
1048140891 8:131793153-131793175 AGCCACCATGTAAACCAGGATGG - Intergenic
1048213024 8:132472178-132472200 AGCCACTATGGAAAGCAATATGG + Intronic
1048446125 8:134494569-134494591 AGCCTCCACGGAACCCCACCAGG + Intronic
1052559924 9:30071888-30071910 AGCCACTATGGAAAACCGTATGG + Intergenic
1054959277 9:70949412-70949434 AGACAACATGGAGACCCACAAGG + Intronic
1055102439 9:72479767-72479789 AGCCAACGTGGCAACCCACTCGG - Intergenic
1056802727 9:89704549-89704571 AGTCACCGGGGAAAACCACAAGG + Intergenic
1056874476 9:90314864-90314886 AGCCACCATGCACAGCCTCAGGG + Intergenic
1056999547 9:91494886-91494908 AGCTACGATGGAAAACAACATGG - Intergenic
1057526865 9:95810667-95810689 AGCCTCCATAAAAACCCAAAAGG - Intergenic
1057864594 9:98669119-98669141 AGCCACCATGGAAAACAATATGG - Intronic
1058712868 9:107696194-107696216 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1060231478 9:121828458-121828480 AGCCACCATGGCTGGCCACACGG + Intronic
1060466679 9:123912918-123912940 GGCCTCCATGGAAACCTCCATGG - Intronic
1060739087 9:126086177-126086199 AGACACCAAGGACATCCACATGG - Intergenic
1062702254 9:137913446-137913468 ACCCTCCATGAAAGCCCACAGGG + Intronic
1185958536 X:4519641-4519663 AGGCATTATGGAAAGCCACATGG - Intergenic
1186505998 X:10092752-10092774 CTCCACCATGGAACACCACATGG - Intronic
1186688975 X:11954828-11954850 AGCCCCCAAGGACACCAACAAGG - Intergenic
1187566531 X:20455062-20455084 AGCAACCATGCAAATCCAGAAGG - Intergenic
1188022789 X:25176715-25176737 AGCCAGCATTGAAAACCAGACGG + Intergenic
1188116868 X:26254921-26254943 AGCCATTATGGAAAACAACATGG - Intergenic
1188586624 X:31784414-31784436 AGCCACTATGGAAAACCGTATGG + Intronic
1188816714 X:34723957-34723979 AGCCACCATGGAAAGCAATTTGG - Intergenic
1189509954 X:41652652-41652674 AGCCTCCATAGAAACCCAAAAGG + Intronic
1190377908 X:49807990-49808012 AGCCTCCATAGAAACACAAAAGG - Intergenic
1190653744 X:52592918-52592940 AACCTCCATGAAAACCCAAAAGG + Intergenic
1190796304 X:53746553-53746575 AGCCACCATGCAAAACAGCATGG - Intergenic
1191105416 X:56769194-56769216 AGCCACCTGTGAAACCCACCCGG - Intergenic
1191106409 X:56774596-56774618 AGCCACCTGTGAAACCCACCCGG - Intergenic
1191107402 X:56779998-56780020 AGCCACCTGTGAAACCCACCCGG - Intergenic
1191637656 X:63394662-63394684 ATCCACTATGGAAAACCATATGG - Intergenic
1191767768 X:64718745-64718767 AGCCATTATGGAAAACAACATGG + Intergenic
1191896887 X:66002280-66002302 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1192030365 X:67505464-67505486 AGCCACCATGGAAAACAGTATGG - Intergenic
1192241043 X:69328698-69328720 AGCCACCATGGAAACAAGCATGG - Intergenic
1192725893 X:73752030-73752052 CACCACCATGCCAACCCACAAGG + Intergenic
1192760058 X:74087180-74087202 AGCCACTATGGAAAACAATATGG + Intergenic
1192938794 X:75891197-75891219 AGCCACCATGGAAAACAGTATGG + Intergenic
1193506837 X:82354946-82354968 AGCCACTATGGAAAACAATATGG + Intergenic
1193578941 X:83237954-83237976 AGCCACTATGGAAAACCATGTGG + Intergenic
1193646365 X:84073940-84073962 AGCCACTATGGAAAACTGCATGG + Intronic
1194015848 X:88619579-88619601 ATCCACTATGGAAAACCATATGG + Intergenic
1194558439 X:95391540-95391562 AGCCACTATGGAAAACAATATGG - Intergenic
1194837828 X:98702994-98703016 AGCCACTATGGAAAACAATATGG - Intergenic
1195382976 X:104288578-104288600 AGCCTCCATAAAAACCCAAAAGG + Intergenic
1195596461 X:106696860-106696882 ACACACCATGGAAAACCACAGGG + Intronic
1195818493 X:108915766-108915788 AACCACTATGGAAAACCATATGG + Intergenic
1195972189 X:110485063-110485085 ATCCACTATGGAAACCAGCATGG - Intergenic
1196136528 X:112215871-112215893 AGCCACCATGGAAAACAGTATGG - Intergenic
1196169084 X:112567181-112567203 AGCCACTATGGAAAACAATATGG - Intergenic
1197144148 X:123152764-123152786 AGCCACCATGGAAAACAGCCTGG + Intergenic
1198283560 X:135168010-135168032 AGCCACCATGGAAAACAGTATGG + Intronic
1198550402 X:137739093-137739115 AGCCACTATGGAAAACAATATGG - Intergenic
1199054893 X:143282216-143282238 TGCTACCATGGATCCCCACATGG + Intergenic
1199808421 X:151325678-151325700 AGTTACCATGGAAAGGCACAAGG + Intergenic
1200019812 X:153193241-153193263 AGCCACCATGGAAAACAGTATGG - Intergenic
1200056918 X:153466428-153466450 AGGCCCCAAGGAAAGCCACAGGG + Intronic
1200330904 X:155296878-155296900 AGCCACTATGGAAAACAGCATGG + Intronic