ID: 1073006848

View in Genome Browser
Species Human (GRCh38)
Location 10:100330915-100330937
Sequence ACAAGGAATATAGACAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073006848_1073006850 -1 Left 1073006848 10:100330915-100330937 CCTAGGTTGTCTATATTCCTTGT No data
Right 1073006850 10:100330937-100330959 TTCTGAAGCTTGCCTTTCCATGG No data
1073006848_1073006857 29 Left 1073006848 10:100330915-100330937 CCTAGGTTGTCTATATTCCTTGT No data
Right 1073006857 10:100330967-100330989 GTGAGATACACCAAGAGAGGGGG No data
1073006848_1073006856 28 Left 1073006848 10:100330915-100330937 CCTAGGTTGTCTATATTCCTTGT No data
Right 1073006856 10:100330966-100330988 GGTGAGATACACCAAGAGAGGGG No data
1073006848_1073006854 26 Left 1073006848 10:100330915-100330937 CCTAGGTTGTCTATATTCCTTGT No data
Right 1073006854 10:100330964-100330986 CAGGTGAGATACACCAAGAGAGG No data
1073006848_1073006855 27 Left 1073006848 10:100330915-100330937 CCTAGGTTGTCTATATTCCTTGT No data
Right 1073006855 10:100330965-100330987 AGGTGAGATACACCAAGAGAGGG No data
1073006848_1073006851 7 Left 1073006848 10:100330915-100330937 CCTAGGTTGTCTATATTCCTTGT No data
Right 1073006851 10:100330945-100330967 CTTGCCTTTCCATGGCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073006848 Original CRISPR ACAAGGAATATAGACAACCT AGG (reversed) Intergenic
No off target data available for this crispr