ID: 1073009425

View in Genome Browser
Species Human (GRCh38)
Location 10:100347938-100347960
Sequence GTGAACTACGGCGCTGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073009418_1073009425 7 Left 1073009418 10:100347908-100347930 CCGTTGCGTCTCGGATACACCCT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1073009425 10:100347938-100347960 GTGAACTACGGCGCTGCGGAAGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073009425 Original CRISPR GTGAACTACGGCGCTGCGGA AGG Intronic
900578088 1:3394140-3394162 CTGATCCGCGGCGCTGCGGAAGG - Intronic
912434879 1:109654762-109654784 GAGGAGTACGGCTCTGCGGAAGG - Intergenic
1073009425 10:100347938-100347960 GTGAACTACGGCGCTGCGGAAGG + Intronic
1089204598 11:116749471-116749493 GTTAACTACAGCACTGGGGATGG + Intronic
1105411112 13:20172388-20172410 GTGAACAGCGGCGCAGGGGAGGG + Intergenic
1110288180 13:73773901-73773923 TTGAACTGCGGAGCTGAGGAAGG - Intronic
1122814441 14:104305579-104305601 GTGAACTGGGCTGCTGCGGATGG + Intergenic
1141105370 16:81229109-81229131 GTGAACTTCGGGGCTGGAGAAGG - Intergenic
1159903900 18:74073576-74073598 GTGGACTACGTTGATGCGGAAGG - Exonic
1160769186 19:822541-822563 GTGGACCCCGGCGCGGCGGAGGG - Intergenic
1165444528 19:35849511-35849533 GCCAACTAGGGCGCTGAGGATGG - Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1179270659 21:39848065-39848087 GTGAACTCAGGGGCTGTGGATGG + Intergenic
1183724111 22:39578921-39578943 GAGAACCACGGCGATGGGGAAGG - Intronic
966113904 3:176437828-176437850 GTGAACTACAGGGGAGCGGATGG - Intergenic
1006068024 6:31476583-31476605 GTGAACCACAGCTCTGTGGAGGG - Intergenic
1034434763 7:151058154-151058176 GGGAACCACGGCGCCGCGGCGGG - Exonic
1036723946 8:11201781-11201803 GTGAGCTGCGACGCTGAGGAAGG - Intergenic
1056732284 9:89177293-89177315 GGGAACTAGGGCGCTGCGCTTGG - Intronic
1057690826 9:97283100-97283122 GTAAACTATGGTACTGCGGAAGG - Intergenic