ID: 1073018176

View in Genome Browser
Species Human (GRCh38)
Location 10:100418824-100418846
Sequence TTAAGTACACACATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073018168_1073018176 14 Left 1073018168 10:100418787-100418809 CCCAAAACCCCACAGTGGTATAG No data
Right 1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG No data
1073018170_1073018176 7 Left 1073018170 10:100418794-100418816 CCCCACAGTGGTATAGCTTCCAG No data
Right 1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG No data
1073018167_1073018176 15 Left 1073018167 10:100418786-100418808 CCCCAAAACCCCACAGTGGTATA No data
Right 1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG No data
1073018171_1073018176 6 Left 1073018171 10:100418795-100418817 CCCACAGTGGTATAGCTTCCAGT No data
Right 1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG No data
1073018166_1073018176 16 Left 1073018166 10:100418785-100418807 CCCCCAAAACCCCACAGTGGTAT No data
Right 1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG No data
1073018172_1073018176 5 Left 1073018172 10:100418796-100418818 CCACAGTGGTATAGCTTCCAGTA No data
Right 1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG No data
1073018169_1073018176 13 Left 1073018169 10:100418788-100418810 CCAAAACCCCACAGTGGTATAGC No data
Right 1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073018176 Original CRISPR TTAAGTACACACATGGAGCT GGG Intergenic
No off target data available for this crispr