ID: 1073023230

View in Genome Browser
Species Human (GRCh38)
Location 10:100464956-100464978
Sequence TTTCTCTGCATGGCATAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073023230 Original CRISPR TTTCTCTGCATGGCATAAAG GGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
903109850 1:21122486-21122508 TTTTTTTGCATGTCATAAATTGG + Intronic
905607928 1:39320395-39320417 ATTTTCTGCATGCCAAAAAGAGG + Intronic
905871050 1:41404778-41404800 TTTCTTTCCTTGGCATAAATGGG + Intergenic
906247810 1:44289440-44289462 TTTCCCTGGATGGAATAGAGAGG - Intronic
906597249 1:47090143-47090165 CTTCTCTTCATAGCTTAAAGTGG + Intronic
906869893 1:49466578-49466600 TTTATCTGCATGAGATATAGAGG + Intronic
907305575 1:53511150-53511172 TTTATGTACATGGCAGAAAGAGG + Intronic
909024682 1:70468423-70468445 TTTCTGTGCATCGCATGCAGGGG - Intergenic
909037692 1:70612937-70612959 ATTGTCTGTATGCCATAAAGTGG + Intergenic
910141019 1:84027872-84027894 TTTCTCTGCAGAGCATAAATGGG - Intergenic
910787442 1:91015750-91015772 TTTATCGGCATGGCTTAAAATGG + Intronic
911354670 1:96801496-96801518 TTTCTCTTAATAGCATACAGTGG + Intronic
913310381 1:117484608-117484630 GTTCACTGCATAGCAAAAAGAGG + Intronic
915842193 1:159223220-159223242 TTTCTCTGAATTGCAAAAATTGG - Intergenic
916120958 1:161527484-161527506 TTTCTGCCCATGGCATAATGAGG + Intergenic
916130731 1:161609122-161609144 TTTCTGCCCATGGCATAATGAGG + Intronic
918065931 1:181101812-181101834 TTTGTCTGTATGGCAAGAAGGGG - Intergenic
919496280 1:198273393-198273415 TTTCTTTGGAAGGCATAATGAGG - Intronic
923592512 1:235331465-235331487 TTTGTCTGCTTGGCATTAAAGGG + Intronic
1063521161 10:6742606-6742628 TTTGTCTGAGGGGCATAAAGCGG + Intergenic
1064487384 10:15808415-15808437 TTTCTCTGCATGTAATAAAACGG - Intronic
1065913397 10:30330376-30330398 TATCTCAGGATGGCAAAAAGAGG + Intronic
1066585876 10:36934763-36934785 CTTCTCTGTATGACAAAAAGAGG - Intergenic
1067962419 10:50869407-50869429 TTTCTCTGCATTGGAGAAACAGG - Intronic
1070010793 10:72472411-72472433 TTTTTCTTCATCGCATACAGAGG - Intronic
1070529056 10:77320371-77320393 TTTCTCTGCAAGGAAGGAAGGGG + Intronic
1072510800 10:96122599-96122621 TTTCTCTTCATGGAAAAGAGGGG + Intergenic
1073023230 10:100464956-100464978 TTTCTCTGCATGGCATAAAGGGG - Intronic
1073769608 10:106721166-106721188 TTTCTCAGCATGTCAGGAAGTGG + Intronic
1074245495 10:111687145-111687167 TTTTTCTGCTTGGCATAGAGGGG + Intergenic
1077005289 11:352273-352295 TTTCTCTACATGGTCTAAAAGGG - Intergenic
1078422185 11:11221545-11221567 TTACTCTGTATGGCTTAAAAAGG + Intergenic
1080830952 11:35892818-35892840 TATCTCCACATGGCAGAAAGAGG - Intergenic
1080853613 11:36092674-36092696 TTTGTCTGCAAGGCAGTAAGTGG + Intronic
1080993269 11:37568180-37568202 TGTCTCAGCATGTCATAAAAAGG + Intergenic
1081408188 11:42722599-42722621 TTTCTCTGCATGAGATGCAGGGG - Intergenic
1082153240 11:48769235-48769257 TTTTTCAGCATGGCCTCAAGGGG + Intergenic
1084263498 11:67993377-67993399 TCTCTCTTCATGGCCTGAAGGGG - Intronic
1085478139 11:76800606-76800628 TTACTGTGAAAGGCATAAAGAGG - Intergenic
1087347958 11:96995103-96995125 TTTCTCTGCATGACAGAATCAGG - Intergenic
1088042898 11:105409936-105409958 TCTCTCTGAAGGGCATGAAGGGG - Intergenic
1089553627 11:119301694-119301716 CTTCTCTACATGGCATAAAGCGG + Exonic
1090766056 11:129877271-129877293 TCTCTCTGCATGGCTCACAGAGG + Intronic
1092852340 12:12641048-12641070 TTTTTCTATATGGTATAAAGTGG + Intronic
1094784174 12:33826532-33826554 TTTCCCTAGATGGCCTAAAGAGG + Intergenic
1098914787 12:76246063-76246085 TGTCCCTACATGGCAGAAAGTGG + Intergenic
1099009747 12:77277646-77277668 TTTCTCTCCAAGGAATAAAAGGG + Intergenic
1100130758 12:91490284-91490306 TGTCTCTGAATAGCAGAAAGAGG - Intergenic
1100775955 12:97974756-97974778 TTTCTTTGGCTGGCATAATGGGG - Intergenic
1101755172 12:107615945-107615967 CTGCTCTGCATGGAATCAAGAGG - Intronic
1102554370 12:113717212-113717234 TTCCTCTGCATGGGCTAAATTGG - Intergenic
1104880283 12:132065937-132065959 TATCTCTGCAGGACATAAGGGGG - Intronic
1105944161 13:25175565-25175587 TTTCTGTTCATCTCATAAAGAGG - Intergenic
1108057339 13:46497932-46497954 TTGCTCTGCAAAGCCTAAAGGGG - Intergenic
1108461823 13:50674653-50674675 CTTCTCTGCTTGGGATAAGGAGG + Intronic
1108724885 13:53169686-53169708 ATTCTCTGTAGGGCATCAAGAGG - Intergenic
1109023871 13:57135382-57135404 TTTCTCTACATGGAGTAAGGTGG + Intergenic
1109518645 13:63478038-63478060 TTTGTCTACATGACATATAGTGG - Intergenic
1109592711 13:64507412-64507434 TTTATTTGCTTTGCATAAAGTGG + Intergenic
1111711450 13:91819743-91819765 TTTCTCTGCAATGCATACTGAGG + Intronic
1112192330 13:97190109-97190131 TATCTTAGCATGGCAGAAAGCGG + Intergenic
1112783211 13:102924875-102924897 TCTCTTTGCATGGCATCAGGAGG - Intergenic
1113112641 13:106840631-106840653 TTTCTCTCCAAGGCACAAAAGGG + Intergenic
1114264386 14:21063982-21064004 TTACTCTGAATGGCTCAAAGCGG - Intronic
1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG + Intronic
1116558340 14:46342653-46342675 TTTCTCTGCATTGTATCAGGAGG + Intergenic
1118123082 14:62867904-62867926 GTTATGTGCATGGCATAAGGGGG - Intronic
1118729992 14:68659355-68659377 TTTCTTTGCTTGGCTTAAAGGGG - Intronic
1118902273 14:69996473-69996495 ATTCTCTGCATGTAGTAAAGTGG + Intronic
1119527879 14:75336782-75336804 CTTCTTTGCATGCCATAAGGAGG + Intergenic
1125346289 15:38722253-38722275 TTACTCTGTATGACATAAATAGG - Intergenic
1125575289 15:40751250-40751272 TTTGTCTGAATGACATAAATTGG + Intronic
1126098432 15:45105527-45105549 TTTCTCTCCAGGCCATAGAGCGG + Intronic
1126421828 15:48482530-48482552 TTTAACTTCATGGCATAAGGAGG + Intronic
1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG + Intronic
1130722341 15:86400792-86400814 TATATCAGCATGGCATAAAATGG - Intronic
1133395719 16:5445770-5445792 TTTTTCTAGATGGCTTAAAGAGG + Intergenic
1133603291 16:7360980-7361002 TTTCTCATCATGGCACACAGAGG - Intronic
1134810192 16:17160867-17160889 TTTCTCTCCAAACCATAAAGAGG + Intronic
1136092240 16:27928812-27928834 TTCCTCTGGCTGGCATTAAGTGG - Intronic
1138700037 16:58852986-58853008 TTTGTTTTCATGGCACAAAGTGG - Intergenic
1139966617 16:70749248-70749270 ATTCTCTGCAGGGGAGAAAGCGG - Intronic
1147846231 17:43405819-43405841 TTTCTCTGCATGTACAAAAGAGG + Intergenic
1148163265 17:45463979-45464001 TTCCTTTGCCTGGCATAATGAGG - Intronic
1149957964 17:61074870-61074892 TTCCACTGCATGGAATGAAGTGG + Intronic
1150394497 17:64810631-64810653 TTCCTTTGCCTGGCATAATGAGG - Intergenic
1157642112 18:49226925-49226947 TTTCTCTGGATGACATTAAAAGG - Intronic
1158235699 18:55310821-55310843 TTTCCCTACAGGACATAAAGTGG - Intronic
1159465494 18:68777580-68777602 TTTCTTGGCATGGGTTAAAGGGG + Intronic
1161210786 19:3064270-3064292 GTTCTCTGCGTGGCAGAGAGAGG - Intergenic
1162248176 19:9420280-9420302 TCTCTCTGCAGAGCATATAGAGG + Exonic
1162965064 19:14151611-14151633 GTGCTCTGCAGGGCAGAAAGGGG + Exonic
1164069761 19:21756610-21756632 TTTCTATCCATGGCATAAAATGG - Intronic
1164263745 19:23594027-23594049 CTTCCCTGCATTACATAAAGTGG - Intronic
1164845007 19:31424567-31424589 TTTCTCTGCCTGGCAGACATAGG - Intergenic
1165374112 19:35429579-35429601 GTTGTTTGCATGGCATGAAGTGG - Intergenic
925328777 2:3042585-3042607 TGTCTCTACCTGGGATAAAGGGG - Intergenic
926469966 2:13242688-13242710 TTTCACTGCATGAGAGAAAGGGG - Intergenic
926677284 2:15636654-15636676 TTTCTCTGCAGGGCAATAATTGG + Intergenic
928896431 2:36270028-36270050 TTTCTTTCCATGTAATAAAGGGG - Intergenic
930307079 2:49687972-49687994 TTTCTCTGCACTGTATAATGTGG - Intergenic
931164222 2:59728818-59728840 TTTCTCTTCATGGATTAGAGAGG - Intergenic
931233711 2:60395716-60395738 TTTGTCTGCATGGCATTGTGGGG - Intergenic
935797246 2:106656271-106656293 TTAATCTGCATGCCAAAAAGAGG - Intergenic
936027047 2:109040123-109040145 TTTTTCTGTATGGCATGAAGTGG + Intergenic
937477843 2:122230671-122230693 CTTCCCTGCATAGCATCAAGAGG + Intergenic
937727109 2:125180084-125180106 TTCCTCAGCATGGCATAGAAAGG + Intergenic
937834670 2:126460149-126460171 TTTCTCTCCTTGGCATGAATTGG - Intergenic
941551160 2:166917036-166917058 TTTCTCTGAAGGACATATAGTGG - Intronic
943400977 2:187410629-187410651 TTTCTTTGCAGGGAATAAACTGG + Intronic
943893632 2:193323894-193323916 CTTCTCTGCTTGGCATGAACTGG - Intergenic
946651736 2:221898844-221898866 TTTCTCTTCATGGAATTATGAGG + Intergenic
947162440 2:227227960-227227982 ATTCTCTGCATTGCATAAGACGG + Intronic
948001551 2:234572158-234572180 TTAGTCTGCATGCCCTAAAGAGG + Intergenic
1170255164 20:14334437-14334459 TTTCTCTTCAGAGCATAAAAAGG - Intronic
1170864811 20:20143873-20143895 TTTCTCAGCCTGGCCTTAAGGGG - Intronic
1171445089 20:25197018-25197040 TTTCTCTCCTTGGCAAAAACCGG - Intronic
1172400015 20:34642022-34642044 TTTCTTTGCATGATTTAAAGAGG - Intronic
1172906332 20:38372680-38372702 GCTCTCTGCTTGGCATATAGTGG + Intronic
1173357023 20:42303050-42303072 TTTCTCTGCACCTCATGAAGAGG + Intronic
1175242234 20:57558203-57558225 TTTCTCTGCATGCCAGAAATGGG - Intergenic
1179117765 21:38509740-38509762 TTTCTCTGCAAGTCACAAAGGGG - Intronic
1181927827 22:26374774-26374796 TTTCCCAGCATAGCTTAAAGGGG - Intronic
1181944306 22:26503760-26503782 TTTCTCTGCTTGGCTTCAATTGG + Exonic
1182175217 22:28278934-28278956 TTTCTTTTCATGGCATAGGGAGG + Intronic
1183018101 22:35006503-35006525 TTTCTCTTCTTGGCATAAGGGGG - Intergenic
1184303259 22:43576464-43576486 ATTTTCTGCATTGGATAAAGAGG - Exonic
952069501 3:29617012-29617034 TTTCACTGCAGTGCATAAAGGGG + Intronic
952190093 3:31014033-31014055 TTTCTCTGCATGGCCTAGTTTGG - Intergenic
952194839 3:31064299-31064321 TTACTCTCCTTGGTATAAAGTGG - Intergenic
952223904 3:31353909-31353931 TTTCTCTGTATGGCCTCATGAGG - Intergenic
954527306 3:51283473-51283495 TTTCTCTGCATTGCTTCTAGAGG - Intronic
954577238 3:51683351-51683373 TTTCTCCTCCTGGCATCAAGAGG - Intronic
956515925 3:70047784-70047806 TGTCTTTGCATGGCAGAAAGCGG + Intergenic
957880436 3:86205290-86205312 TTTCTCCATATGGCATAAATAGG + Intergenic
961195514 3:124998299-124998321 TGTGTCTGCATGGCCTAAAAAGG + Intronic
962238843 3:133733191-133733213 TTTGACAGCATGGCATAAAGTGG - Intergenic
962855298 3:139339727-139339749 TGTCACTGCATGGAATAAATTGG + Intronic
963266188 3:143242422-143242444 TTTGTCTGCCTGTCATTAAGTGG - Intergenic
965600785 3:170452740-170452762 TCTCTCTACATGGCATATATAGG - Intronic
965743840 3:171904509-171904531 TTTCTCTCTTTGGAATAAAGAGG + Intronic
966341694 3:178932129-178932151 TTTTTGTGTATGGCATAAGGAGG - Intergenic
966349601 3:179017552-179017574 TTTCTCTAAATGTCATACAGAGG - Exonic
966357789 3:179100392-179100414 TTTCTTTGAACTGCATAAAGGGG - Intergenic
966457784 3:180137235-180137257 CTTCTCTTCATGGTATAAAGAGG + Intergenic
967589321 3:191254147-191254169 TTTATCTGCATCACATATAGAGG - Intronic
970229389 4:13893152-13893174 TGTCTTCGCATGGCAGAAAGAGG + Intergenic
970931109 4:21513088-21513110 TTTCTCTGCCTGGAACATAGTGG - Intronic
970979959 4:22084728-22084750 GTTCTAACCATGGCATAAAGGGG - Intergenic
972826193 4:42761898-42761920 GTTCTCTGCCTGGAATTAAGAGG - Intergenic
973561753 4:52144026-52144048 GTGTTCAGCATGGCATAAAGTGG + Intergenic
974344479 4:60661651-60661673 TTTTTCTACATGGCAAAAAGGGG - Intergenic
975582106 4:75916164-75916186 TTTTGCAGCATGGCACAAAGGGG + Intronic
980792862 4:137642211-137642233 TTTCTCTACATGGCACATAAAGG + Intergenic
981695018 4:147551284-147551306 TTTCTTTGTATGGCACAAATAGG - Intergenic
981912655 4:149999646-149999668 TTTCTCTGCCTGGCAGAAGGTGG + Intergenic
985303283 4:188512431-188512453 TTTCTCTGCACGGGGTACAGTGG - Intergenic
985794557 5:1952547-1952569 TTTATCAGGATGACATAAAGAGG + Intergenic
987275854 5:16361782-16361804 ATTCTCAGCATGGCAACAAGAGG - Intergenic
990165896 5:52992813-52992835 TTTCTTGGCATGTCATAAAAAGG + Intronic
990497907 5:56367252-56367274 TATCTCCACATGGCAGAAAGAGG + Intergenic
990677081 5:58199243-58199265 TTTTTCAGCATGGCATAATTTGG - Intergenic
993274078 5:85834249-85834271 TTTCTTTGCCTGGCAGGAAGAGG + Intergenic
994695636 5:103069993-103070015 TTTCTTTGAATGGCATATATTGG + Intergenic
995530820 5:113090292-113090314 TTTCTCTGCTAGGCATGAGGGGG + Intronic
996367165 5:122715485-122715507 TTTCTCTGCAGTGCAGGAAGTGG - Intergenic
996568684 5:124909107-124909129 TTTCACTGCATGAGATAATGTGG + Intergenic
997709895 5:135995479-135995501 TATCTTTGCATGGCAGAAGGCGG - Intergenic
998725025 5:145002788-145002810 TATCTTTACATGGCAGAAAGAGG - Intergenic
1001947382 5:175791167-175791189 CTTCAATTCATGGCATAAAGTGG - Intergenic
1002662008 5:180797614-180797636 TTGCTCTGCATGGCTTAGAAGGG - Intronic
1003417120 6:5919827-5919849 TTTCACTTCATGGCACACAGAGG - Intergenic
1003885004 6:10513631-10513653 TGGCTCTGCATGGGAAAAAGAGG + Intronic
1004138570 6:12992313-12992335 TTTCACTGCACGGCATAACCAGG + Intronic
1008421379 6:51303552-51303574 TTTGTATGCAAGGCAAAAAGAGG + Intergenic
1008448145 6:51617723-51617745 TATGTCTGCAGGGCATCAAGGGG - Exonic
1009794025 6:68442684-68442706 TTTTTCTGTGTGGCATAAAATGG + Intergenic
1011251464 6:85376499-85376521 TATTTCTGCATGGCAAAAACTGG + Intergenic
1011527362 6:88279707-88279729 TTTGTTTTCATGGCCTAAAGAGG + Intergenic
1011680543 6:89779111-89779133 TTGGTCTGCATGGAATAAGGGGG + Intronic
1013600016 6:111694975-111694997 TCTCCCTGTATGTCATAAAGAGG + Intronic
1015083721 6:129261660-129261682 TTTCTATAAATGGCATAATGAGG - Intronic
1015119276 6:129683763-129683785 TATCTCTGCCTTGCACAAAGTGG + Intronic
1015763736 6:136693079-136693101 TTTTTGTGCATGGCTTAAAATGG + Intronic
1015845955 6:137520877-137520899 TTTCTTTGCAAGTCATAAACAGG + Intergenic
1019867604 7:3727473-3727495 ATTCTCTCCCTGGCAAAAAGAGG - Intronic
1021103989 7:16616399-16616421 TTTCTCTACATTTCACAAAGAGG - Intronic
1021476592 7:21068660-21068682 TTGCTCAACATGGTATAAAGTGG + Intergenic
1022922092 7:35025873-35025895 TTTCTTTGCATGCCATTATGTGG + Intronic
1022975120 7:35549655-35549677 TTGCTTTGCAGGGCATGAAGGGG - Intergenic
1023571034 7:41572082-41572104 TTTCTTCCCATGGCACAAAGGGG - Intergenic
1023660413 7:42466021-42466043 CTTCTCTGCCTGGCATTCAGTGG - Intergenic
1024822281 7:53346671-53346693 TTTCTGTGTATGGCATGAGGAGG + Intergenic
1026390221 7:69893726-69893748 TTTGTCTGCCTTGCATGAAGTGG - Intronic
1030815501 7:114031571-114031593 TGTCTTTACATGGCACAAAGAGG - Intronic
1031774529 7:125891141-125891163 TTTCTCTTCATGATATAAATTGG + Intergenic
1032825729 7:135565962-135565984 TTTCTCTGCCTGCCAAAATGAGG - Intronic
1033867975 7:145715319-145715341 CTTATCTGCATGTCAGAAAGTGG - Intergenic
1034032505 7:147783770-147783792 TGTCTTTTCATGGCAAAAAGGGG - Intronic
1034270762 7:149802570-149802592 CTTCTGTGCATGGCAGAGAGGGG + Intergenic
1034831950 7:154316523-154316545 TTTCTCTGCATCGGAGAAGGTGG - Intronic
1035076549 7:156181428-156181450 GGTGGCTGCATGGCATAAAGTGG - Intergenic
1038000950 8:23390725-23390747 CTTCTCTGCAGCTCATAAAGGGG + Intronic
1038486505 8:27939056-27939078 ATTCTGTGTATGGTATAAAGTGG - Intronic
1039824076 8:41158101-41158123 TCTCTCTGCATGGCTTAGAGGGG - Intergenic
1040421210 8:47242110-47242132 TTTCTCTGCCTGGAATAAATAGG - Intergenic
1044453080 8:92360914-92360936 CTTCTCTGTATGGCAATAAGTGG - Intergenic
1045437357 8:102177251-102177273 TTTTTCTGAAAGGCATAATGGGG + Intergenic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1045906855 8:107355944-107355966 TTTCACTGCCTGGCACATAGTGG + Intronic
1046264018 8:111807360-111807382 TTTCTCTGCTTAGAAGAAAGGGG + Intergenic
1047555673 8:125927254-125927276 CTTCTCTTCATGGCAAGAAGAGG + Intergenic
1047596642 8:126384465-126384487 TTTCTCTGCATGGACTGAAGAGG - Intergenic
1048279717 8:133096140-133096162 TTGCACTGCTTTGCATAAAGAGG - Intronic
1050226713 9:3466062-3466084 GTACTATGCATGGCATAAATAGG - Intronic
1050573365 9:6966011-6966033 TTTCTCTGCATTTAATAAAATGG - Intronic
1052262340 9:26531714-26531736 TTTCTATGGATGGAATAAATAGG - Intergenic
1055071168 9:72167517-72167539 TTTCTGAACATGGCAAAAAGTGG + Intronic
1055946111 9:81692561-81692583 TTTCTCTGCAGAGCATAAAAAGG - Intergenic
1058693779 9:107541740-107541762 TTTCTCAGCATTGCAAACAGTGG - Intergenic
1058886972 9:109329217-109329239 AATCTCTGCACAGCATAAAGAGG - Intergenic
1203451558 Un_GL000219v1:121579-121601 TTTCTCTGCAAAAAATAAAGGGG - Intergenic
1186356420 X:8796033-8796055 TTTATCTGGAAGGCAAAAAGAGG + Intronic
1186378139 X:9030027-9030049 TTTATCTGGAAGGCAAAAAGAGG + Intronic
1186619483 X:11223481-11223503 TTTATCTGGAAGGCAAAAAGAGG - Intronic
1186795186 X:13040524-13040546 TTTATCTGGAAGGCAAAAAGAGG + Intronic
1188781958 X:34296159-34296181 TTTCACTGCCTGAAATAAAGTGG + Intergenic
1189992133 X:46605471-46605493 CTTCTCTGCATGGCACTCAGTGG + Exonic
1192585248 X:72313980-72314002 CTTCTCTCCATGGCACAGAGAGG + Intergenic
1193041387 X:77007376-77007398 TTTCTCTGCATTACAAAATGTGG + Intergenic
1193307301 X:79964219-79964241 TTTCTCTGCAAGGGAAAATGTGG - Intergenic
1193536652 X:82725120-82725142 TTTCTCTTCATTCCATGAAGTGG - Intergenic
1193697792 X:84730205-84730227 GTTCTCTGCATGAGATTAAGAGG + Intergenic
1196649828 X:118157350-118157372 TTTCTCTCCATTGCAGACAGGGG + Intergenic
1198530433 X:137546485-137546507 CTGCTCTGCATGCCAGAAAGAGG - Intergenic
1198926847 X:141807206-141807228 TTTCTTTGCATGGCACAAAGTGG - Intergenic