ID: 1073024089

View in Genome Browser
Species Human (GRCh38)
Location 10:100473634-100473656
Sequence ATTCTATTATGGGTTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073024083_1073024089 10 Left 1073024083 10:100473601-100473623 CCAGTACTTCATTCCTTTATATG 0: 1
1: 14
2: 77
3: 1030
4: 1418
Right 1073024089 10:100473634-100473656 ATTCTATTATGGGTTGGACATGG No data
1073024082_1073024089 28 Left 1073024082 10:100473583-100473605 CCATGTTGTAGCTTGTATCCAGT No data
Right 1073024089 10:100473634-100473656 ATTCTATTATGGGTTGGACATGG No data
1073024085_1073024089 -3 Left 1073024085 10:100473614-100473636 CCTTTATATGGTCAAAAAATATT 0: 1
1: 0
2: 15
3: 203
4: 1165
Right 1073024089 10:100473634-100473656 ATTCTATTATGGGTTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073024089 Original CRISPR ATTCTATTATGGGTTGGACA TGG Intronic
No off target data available for this crispr