ID: 1073025492

View in Genome Browser
Species Human (GRCh38)
Location 10:100484331-100484353
Sequence CAGCTCTTCTAGAGCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073025477_1073025492 24 Left 1073025477 10:100484284-100484306 CCCAGCCAGCTTCCTTGCCCTAG No data
Right 1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG No data
1073025491_1073025492 -6 Left 1073025491 10:100484314-100484336 CCAGGTCTGGGGCTGGGCAGCTC No data
Right 1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG No data
1073025480_1073025492 19 Left 1073025480 10:100484289-100484311 CCAGCTTCCTTGCCCTAGGACAG No data
Right 1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG No data
1073025490_1073025492 -5 Left 1073025490 10:100484313-100484335 CCCAGGTCTGGGGCTGGGCAGCT No data
Right 1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG No data
1073025483_1073025492 7 Left 1073025483 10:100484301-100484323 CCCTAGGACAGTCCCAGGTCTGG No data
Right 1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG No data
1073025478_1073025492 23 Left 1073025478 10:100484285-100484307 CCAGCCAGCTTCCTTGCCCTAGG No data
Right 1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG No data
1073025481_1073025492 12 Left 1073025481 10:100484296-100484318 CCTTGCCCTAGGACAGTCCCAGG No data
Right 1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG No data
1073025485_1073025492 6 Left 1073025485 10:100484302-100484324 CCTAGGACAGTCCCAGGTCTGGG No data
Right 1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073025492 Original CRISPR CAGCTCTTCTAGAGCAGAAC TGG Intergenic
No off target data available for this crispr