ID: 1073027057

View in Genome Browser
Species Human (GRCh38)
Location 10:100495749-100495771
Sequence GTGGAAAACCGGGATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073027052_1073027057 7 Left 1073027052 10:100495719-100495741 CCATGGTTTTTGGTTTGTCTCTA 0: 1
1: 1
2: 13
3: 41
4: 468
Right 1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG No data
1073027051_1073027057 14 Left 1073027051 10:100495712-100495734 CCTGAAGCCATGGTTTTTGGTTT 0: 3
1: 55
2: 64
3: 69
4: 319
Right 1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073027057 Original CRISPR GTGGAAAACCGGGATGAGGA AGG Intronic
No off target data available for this crispr